Información

¿Cuál es el protocolo adecuado de congelación rápida / congelación instantánea para el tejido pancreático?

¿Cuál es el protocolo adecuado de congelación rápida / congelación instantánea para el tejido pancreático?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Me gustaría congelar rápidamente el páncreas de los ratones. Luego quiero hacer secciones (de 30 µm de grosor). La idea es conservar una tinción fluorescente realizada en vivo.

No sé si debo colocar mi tejido fresco directamente en nitrógeno líquido, luego incrustar el tejido en OCT y luego congelar todo en isopentano frío.

¿O tengo que incrustar el tejido fresco en OCT primero, antes de poner todo en nitrógeno?

¿O hay otro protocolo para hacer una congelación rápida para poder seccionar?


Incruste el tejido en OCT primero (corte aproximadamente para eliminar todo lo que no se necesita) y el flash lo congela. Entonces puedes cortar tus secciones.

El primer protocolo lo describe en detalle, el segundo brinda información adicional:


no lo coloque directamente en el N2 a menos que esté limpio. y el N2 líquido de alta calidad cuesta un brazo y una pierna. poner el tejido en el oct en un vial cónico y eso en el N2. no use policarbonato, puede agrietarse. Sin embargo, consulte primero las sugerencias de los fabricantes de OCT. He seguido este protocolo de BD antes

http://www.bdbiosciences.com/resources/protocols/frozen_tissue.jsp


Optimización del método para extraer ARN de alta calidad del tejido del páncreas humano 1,2

La secuenciación de ácidos nucleicos se utiliza con frecuencia para determinar la base molecular de las enfermedades. Por lo tanto, el almacenamiento adecuado de las muestras biológicas es esencial para inhibir la degradación del ácido nucleico. El ARN aislado del páncreas humano es generalmente de mala calidad debido a su alta concentración de ARNasa endógena. En este estudio, optimizamos el método para extraer ARN de alta calidad del tumor emparejado y tejidos pancreáticos normales obtenidos de ocho pacientes con cáncer de páncreas después de la cirugía. Se verificó el número de integridad del ARN (RIN) para evaluar la integridad del ARN, intentamos extraer el ARN con un valor de RIN de 8 o superior que permita el último análisis genético. El efecto de varios parámetros, incluido el método utilizado para la lisis de tejidos, ARNmás tarde Se examinó el tratamiento, el peso del tejido en el almacenamiento y el tiempo de almacenamiento después de la resección quirúrgica, sobre la cantidad y calidad del ARN extraído. Los datos mostraron que la mayor cantidad de ARN se aisló utilizando una combinación de métodos manuales y mecánicos de lisis de tejidos. Además, seccionar los tejidos en trozos pequeños (& lt100 mg) y tratarlos con ARNmás tarde solución antes del almacenamiento aumentó la estabilidad del ARN. Siguiendo estas pautas, se obtuvo ARN de alta calidad del 100% (8/8) de los tejidos tumorales y del 75% (6/8) de los tejidos normales. El ARN de alta calidad seguía siendo estable con la congelación y descongelación repetidas. La aplicación de estos resultados durante la manipulación y el almacenamiento de muestras en entornos clínicos facilitará el diagnóstico genético de enfermedades y su posterior tratamiento.

Financiamiento: Este estudio fue apoyado por una subvención del Proyecto Coreano de Investigación y Desarrollo de Tecnología de la Salud, Ministerio de Salud y Bienestar, República de Corea (No. HI14C2640).

Intereses en competencia: los autores declaran que no tienen intereses en competencia.


Protocolo de recolección para páncreas humano

Este video muestra un procedimiento de disección para procesar el páncreas humano en múltiples formatos de almacenamiento. La orientación anatómica se mantiene en todas las regiones pancreáticas para permitir la definición de la composición y densidad de los islotes regionales.

Abstracto

Este procedimiento de disección y muestreo fue desarrollado para el programa Network for Pancreatic Organ Donors with Diabetes (nPOD) para estandarizar la preparación del páncreas recuperado de donantes de órganos cadavéricos. El páncreas se divide en 3 regiones principales (cabeza, cuerpo, cola) seguidas de secciones transversales en serie a lo largo del eje medial a lateral. Se utilizan secciones alternas para parafina fijada y bloques congelados frescos y las muestras remanentes se trituran para preparaciones de muestras congeladas instantáneamente, con o sin inhibidores de ARNasa, para aislamiento de ADN, ARN o proteínas. El objetivo general del procedimiento de disección del páncreas es tomar muestras de todo el páncreas mientras se mantiene la orientación anatómica.

La heterogeneidad de las células endocrinas en términos de composición, tamaño y número de islotes se informa para los islotes humanos en comparación con los islotes de roedores 1. La mayoría de los islotes humanos de las regiones de la cabeza, el cuerpo y la cola del páncreas están compuestos por células & beta que contienen insulina, seguidas de proporciones más bajas de células & alfa que contienen glucagón y células & delta que contienen somatostatina. Las células PP que contienen polipéptido pancreático y las células épsilon que contienen grelina también están presentes, pero en pequeñas cantidades. Por el contrario, la región uncinada contiene islotes que se componen principalmente de células PP que contienen polipéptido pancreático 2. Estas variaciones regionales de los islotes surgen de diferencias de desarrollo. El páncreas se desarrolla a partir de las yemas pancreáticas ventral y dorsal en el intestino anterior y, después de la rotación del estómago y el duodeno, el lóbulo ventral se mueve y se fusiona con el dorsal 3. El lóbulo ventral forma la porción posterior de la cabeza, incluido el proceso uncinado, mientras que el lóbulo dorsal da lugar al resto del órgano. También se informa de variación pancreática regional con la región de la cola que tiene una densidad de islotes más alta en comparación con otras regiones y los componentes derivados del lóbulo dorsal que sufren atrofia selectiva en la diabetes tipo 1 4,5.

Los órganos y tejidos adicionales se recuperan a menudo de los donantes de órganos e incluyen ganglios linfáticos pancreáticos, bazo y ganglios linfáticos no pancreáticos. Estas muestras se recuperan con formatos similares a los del páncreas con la adición de aislamiento de células criopreservadas. Cuando el duodeno proximal se incluye con el páncreas, se puede recolectar mucosa duodenal para parafina y bloques congelados y preparaciones congeladas instantáneamente picadas.

Protocolo

  1. Etiquete casetes para bloques de parafina manualmente con un lápiz o automáticamente con una impresora de casetes. Incluya el identificador del donante (CaseID), el tipo de muestra, el número de alícuota y cualquier identificación única adicional (Hoja de trabajo del caso, Apéndice 1).
  2. Etiquete los moldes OCT como para casetes con un marcador permanente. Recorta rectángulos de papel de aluminio de 5 a 10 cm.
  3. Imprima o etiquete manualmente con marcador permanente todos los viales y tubos. Incluya suficientes viales para muestras congeladas picadas y tubos con medio RPMI para envíos frescos. Para los viales congelados instantáneamente con ARN más tarde, agregue 1 ml de ARN más tarde a cada criovial.
  4. Instalar tableros de disección en campana de bioseguridad y encimeras con instrumentos de disección esterilizados (fórceps, bisturís, cuchillas, gasas (4x4)) así como casetes y moldes OCT dispuestos en orden de uso.
  5. Prepare un baño de congelación colocando hielo seco en una caja de poliestireno de tamaño mediano (10x10 cm) a una profundidad de al menos 3 cm y agregue isopentano hasta que el hielo seco esté completamente cubierto.
  6. Opcional: Llene un recipiente pequeño Dewar con nitrógeno líquido.
  7. Si se necesita páncreas para microscopía electrónica (ME), prepare el fijador TAAB agregando 1,25 ml de paraformaldehído al 16%, 1,25 ml de glutaraldehído al 8% y 7,5 ml de PBS 0,1 M. Prepare el fijador Lowicryl agregando 2,5 ml de paraformaldehído al 16% a 7,5 ml de PBS 0,1 M.
  8. Prepare las soluciones utilizadas para aislar células. Para una botella de 500 ml de DMEF (con glutamina), siga técnicas asépticas mientras agrega lo siguiente:
    1. Suero fetal bovino (FBS): agregue 50 ml, final 10%.
    2. Penicilina / Estreptomicina (Pen / Strep, 10,000 U / mL / 10,000 ug / mL stock) - agregue 5 mL Pen / Strep stock a RPMI para una concentración final de 100 U / mL / 100ug / mL. También agregue 5 ml a una botella de 500 ml de DPBS cuando se use para contener ganglios linfáticos o muestras de bazo.
    1. El procedimiento se logra de manera óptima con tres miembros del personal, sin embargo, el procedimiento se puede realizar con una persona bien capacitada. Por lo general, dos personas pueden completar el procedimiento en 90 minutos. La duración real depende de la cantidad de tejidos recibidos y de la facilidad para encontrar los ganglios linfáticos pancreáticos. Las muestras para aislamientos de células se mantienen a 4 ° C hasta que se completa la disección del tejido, mientras que las muestras de suero se procesan en paralelo.
    2. Patólogo, asistente de patología o equivalente: un miembro del personal con experiencia dirige el manejo de tejidos y realiza disecciones importantes, incluidas las divisiones de la cabeza del páncreas y la extracción de los ganglios linfáticos pancreáticos. Los esfuerzos iniciales se dirigen hacia el páncreas, seguidos de un examen de la grasa peripancreática en busca de ganglios linfáticos.
    3. Técnico de laboratorio o miembro del personal equivalente capacitado en el recorte de tejidos cuyas responsabilidades principales son pesar el páncreas y las regiones y recortar los tejidos para bloques fijos y congelados y para viales congelados instantáneamente. Recibe el duodeno y el bazo del asistente de patología y procesa estos órganos mientras el asistente de patología procesa el páncreas.
    4. Asistente de laboratorio: miembro del personal que ayuda a los demás, incluido el etiquetado de viales y bloques, el picado de muestras para crioviales y el procesamiento de suero.

    1. Extraiga el duodeno y el bazo y limpie el páncreas de grasa, vasos y nervios extraños con una disección roma y cortante
    2. Coloque el páncreas limpio en una tabla de disección cubierta con toallas de papel. Sumerja un aplicador con punta de algodón en tinta azul y extiéndalo sobre la superficie anterior del páncreas. Seque el exceso.
    3. Opcional: Sumerja un nuevo aplicador en tinta negra y extiéndalo sobre la superficie posterior del páncreas. Regrese el páncreas a la orientación normal con la superficie anterior hacia el prosector.
    4. Corte el páncreas en 3 regiones: cabeza, cuerpo y cola (Figura 1). Corte la unión entre la cabeza y el cuerpo y luego divida la porción restante en

    1. Pique los trozos y divídalos uniformemente entre los crioviales (& ge1 gramo por vial). Congele rápidamente los viales sin RNALater en nitrógeno líquido o en hielo seco - lechada de isopentano y luego transfiérala a un congelador a -80 ° C.
    2. Mantenga los viales con RNALater a temperatura ambiente durante 30 minutos para permitir el equilibrio, vuelva a mezclar y congele rápidamente en nitrógeno líquido o en la suspensión de hielo seco-isopentano y luego transfiéralo a un congelador a -80 ° C.

    4. Disecciones de bazo, ganglios linfáticos y disecciones de mucosa duodenal

    1. Aísle los ganglios linfáticos pancreáticos (PLN) de la grasa y recorte todo el tejido conectivo hasta la cápsula del ganglio. Coloque en una placa de cultivo celular estéril que contenga DMEF. Dependiendo del número total aislado, divida PLN en alícuotas para envíos frescos, aislamientos de células criopreservadas, bloques de parafina y / o OCT y viales. Pique los nudos grandes en trozos de no más de 0,5 cm.
    2. Pique los ganglios linfáticos no pancreáticos y el bazo en pequeños (

    5. Envuelva los bloques OCT en papel de aluminio preetiquetado y coloque los bloques OCT y los viales en cajas para almacenamiento a largo plazo a -80 ° C.

    6. Envíe muestras fijas para el procesamiento de parafina

    1. Fije los tejidos durante 16 horas (rango de 20 a más de 4 horas) usando un procesador de parafina automático o usando el cronometraje manual. Procese a bloques de parafina utilizando un procesador automático (Apéndice 2).
    2. Incruste las secciones en la orientación exacta que colocó el prosector con la etiqueta del casete a la izquierda. Incruste la mucosa duodenal con la superficie cortada hacia abajo para permitir el examen de la mucosa perpendicular a la submucosa.

    7. Limpiar las áreas de disección y desinfectar. Lave los instrumentos de disección y vuelva a esterilizarlos. Coloque los tejidos humanos remanentes en fijador de formalina para almacenarlos como desechos biomédicos. Deseche los desechos biomédicos de acuerdo con las regulaciones locales dentro de un mes.

    8. Actualizar el sistema de inventario de muestra

    Este procedimiento procesará un páncreas humano intacto con un muestreo representativo de todo el órgano, incluida la demarcación de las tres regiones principales, a saber, cabeza, cuerpo y cola en 2 horas. La región uncina, que se encuentra en la región posterior de la cabeza, se incluye en la disección de la cabeza. El peso medio del páncreas en donantes de órganos sin diabetes fue de 82,4 gramos (52,7 - 139,0 gramos). Los pesos regionales del páncreas fueron aproximadamente iguales (figura 3).

    Este procedimiento también puede permitir la reconstrucción de todo el páncreas utilizando portaobjetos teñidos de bloques secuenciales de parafina y OCT. Son factibles múltiples formatos que permiten la máxima utilización para las tecnologías actuales y futuras. Se proporciona la hoja de trabajo actual del caso nPOD (Apéndice 1) que se utiliza para documentar las muestras recuperadas y el procesamiento posterior por tipos y cantidades de alícuotas.


    Figura 1. Esquema general del procedimiento. Se procesa todo el páncreas manteniendo las orientaciones anatómicas. La región de la cabeza es más larga en el eje superior-inferior debido a la presencia del lóbulo pancreático ventral en la región posterior que incluye la región uncina. El área sombreada en las uniones denota regiones utilizadas para muestras picadas en crioviales. P, Parafina O, OCT.


    Figura 2. Esquema de rotulación de secciones de páncreas. Las rebanadas transversales de páncreas se pueden dividir en mitades o cuartos y se pueden rotular en el sentido de las agujas del reloj.


    Figura 3. Peso del páncreas de donantes de órganos sin diabetes. Se pesó el páncreas intacto de donantes adultos (& gt17 años) y luego se dividió en regiones y se obtuvieron los pesos regionales. Los datos son medias y más SEM (N = 15).

    Se requiere suscripción. Recomiende JoVE a su bibliotecario.

    Discusión

    El objetivo de este procedimiento es definir un procesamiento estándar del páncreas que se pueda armonizar en múltiples sitios de recolección y así permitir la comparación de los resultados obtenidos por diferentes grupos. El método de disección se basa en las prácticas estándar de patología quirúrgica con pasos adicionales para la anotación de las principales regiones del páncreas seguidas de subdivisiones intrarregionales. Se requiere la estandarización de los métodos de procesamiento de muestras biológicas para facilitar la recolección de muestras de alta calidad ejemplificadas por la publicación de las mejores prácticas para la recolección de muestras biológicas de organizaciones nacionales de biobancos como el Instituto Nacional del Cáncer 6. Se ha informado del biobanco de muestras de páncreas humano de donantes que representan diversas etapas de la diabetes y poblaciones de control adecuadas 7-9. Sin embargo, faltan detalles exactos para las muestras recolectadas de la región de la cabeza pancreática. Se conoce una considerable heterogeneidad de islotes interindividuales con variaciones de hasta 5 veces en la distribución del tamaño de los islotes, por lo que se necesita una anotación de la región pancreática al analizar la heterogeneidad inherente [10]. El procesamiento de muestras pancreáticas en formatos estandarizados ayudará a resolver los factores individuales del paciente para que otros factores clave subyacentes de la enfermedad puedan resolverse mejor.


    Biobanco de tejido de cáncer de páncreas humano: impacto de los tiempos de adquisición ex-vivo en la calidad del ARN

    Los bancos de tejidos se han convertido en una iniciativa importante en muchos centros de oncología. La influencia de los tiempos de isquemia cálida ex vivo, los tiempos de almacenamiento y los protocolos de biobancos sobre la integridad del ARN y los datos de microarrays posteriores no está bien documentada.

    Métodos

    En 2001 se inició en el Memorial Sloan-Kettering Cancer Center un protocolo prospectivo aprobado por la junta de revisión institucional para el banco de neoplasias abdominales. Sesenta y cuatro muestras representativas de cáncer de páncreas se congelaron rápidamente en varios momentos de obtención ex-vivo (≤10 min, 11– 30 min, 31-60 min, & gt1 h) y se almacenaron durante tres períodos de tiempo (2001-2004, 2004-2006, 2006-2008). La integridad del ARN se determinó mediante electroforesis microcapilar utilizando el algoritmo del número de integridad del ARN (RIN) y mediante los resultados de la microdisección por captura con láser (LCM).

    Resultados

    En general, el 42% de las muestras de cáncer de páncreas humano almacenadas bajo un protocolo dedicado produjeron ARN con un RIN de ≥7. Los tiempos limitados de isquemia caliente ex vivo no afectaron negativamente la calidad del ARN (porcentaje de tejido con ARN total con RIN ≥7 durante ≤10 min, 42% 11-30 min, 58% 31-60 min, 33% & gt60 min, 42 %), y el almacenamiento a largo plazo de muestras biológicas de cáncer de páncreas almacenadas no influyó negativamente en la calidad del ARN (ARN total con RIN ≥7 almacenado en 2001-2004, 44% 2004-2006, 38% 2006-2008, 50%). El ARN recuperado de muestras de cáncer de páncreas con un RIN de ≥7 sujeto a LCM produjo un ARN adecuado para otras aplicaciones posteriores.

    Conclusiones

    El tejido de páncreas recién congelado almacenado dentro de un protocolo de investigación estandarizado produce ARN de alta calidad en aproximadamente el 50% de las muestras y se puede utilizar para el enriquecimiento mediante LCM. La calidad de los tejidos del biobanco no se vio afectada negativamente por variaciones limitadas de tiempos de isquemia cálida o diferentes períodos de almacenamiento. Este estudio muestra los desafíos y las inversiones necesarias para iniciar y mantener depósitos de tejidos de alta calidad.


    Los organoides cerebrales proporcionan un modelo humano fisiológicamente relevante para el sistema nervioso central. Estos cultivos en 3D permiten el estudio de estados normales y patológicos en el desarrollo del cerebro humano, incluidos los modelos de autismo 1 y esquizofrenia 2, o defectos cerebrales causados ​​por una infección viral. 3

    Una ventaja principal del uso de células madre pluripotentes humanas (hPSC) para crear organoides cerebrales es la recapitulación de la organización en 3D del cerebro en desarrollo. El tejido nervioso central de un organoide cerebral desarrolla una estructura en capas y pseudoventrículos, similar a la estructura cerebral vista in vivo. 3 Para capturar y analizar esta citoarquitectura, se requieren métodos histológicos especializados.

    Hay una serie de consideraciones técnicas al procesar tejidos 3D más grandes que han adquirido una estructura compleja, como los organoides cerebrales. Además de un manejo cuidadoso, estos organoides requieren una adecuada penetración, fijación y crioprotección para preservar su histomorfología. Cada uno de estos pasos también puede afectar la caracterización de fenotipos, mediante la conservación o modificación de la estructura de la proteína que determina la disponibilidad de epítopos.

    El siguiente protocolo describe cómo se pueden procesar organoides cerebrales maduros para criosección e inmunofluorescencia (IF) para minimizar el daño tisular y preservar epítopos importantes. Debido a que la preparación de la muestra tiene una gran influencia en la calidad de la tinción posterior en cualquier protocolo de inmunotinción, algunos anticuerpos pueden funcionar mejor bajo este protocolo con fijadores de tejido basados ​​en deshidratación (Tabla 1). Se confirma que los anticuerpos enumerados en este documento (Tablas 2 y 3) funcionan con tejido organoide cerebral que ha sido tratado con paraformaldehído al 4% para su fijación.


    Preparación de muestras histológicas para microscopía óptica

    La histología es el estudio de células y tejidos, que generalmente se ayuda con el uso de un microscopio óptico. La preparación de muestras histológicas puede variar mucho en función de las propiedades inherentes de las muestras, como el tamaño y la dureza, así como el posprocesamiento esperado, que incluye técnicas de tinción planificadas u otras aplicaciones posteriores. Como se describe en este video, la preparación de la muestra generalmente comienza con un procedimiento de fijación para prevenir la degradación de la muestra por las enzimas naturales que son liberadas por las células al morir. Una vez fijadas, las muestras se colocan en un medio de inclusión que pueda soportar suficientemente la muestra.Por lo general, se trata de cera de parafina, pero también se utilizan otros materiales, como un medio de congelación a base de glicerina y agar, para rodear la muestra durante el corte. Luego, la sección se lleva a cabo en un micrótomo u otro dispositivo de corte que permite al usuario afeitar la muestra en rodajas finas que van desde unas pocas micras hasta unos pocos milímetros de grosor. Una vez cortadas, las secciones se montan en un portaobjetos de vidrio y se tiñen para resaltar las características específicas de la muestra antes de tomar la imagen en un microscopio.

    Procedimiento

    Histología es un término que se refiere al estudio de la anatomía microscópica de tejidos y células. La preparación histológica adecuada de la muestra para microscopía óptica es esencial para obtener resultados de calidad a partir de muestras de tejido.

    Hay 3 pasos principales comunes a casi todos los procedimientos histológicos. En primer lugar, se fija la muestra para preservar el tejido y ralentizar la degradación del tejido. A continuación, la muestra se sumerge en un material, o medio de inclusión, que tiene propiedades mecánicas similares a las mismas. Una vez incrustada, la muestra se secciona o se corta en rodajas finas utilizando una herramienta de corte precisa conocida como micrótomo. Este video describe estos pasos generales y algunos de los conceptos relacionados con ellos.

    La fijación de tejidos es un paso crítico que preserva los componentes de las células y los tejidos y mantiene su estructura. Después de la muerte celular, las enzimas naturales se liberan de los orgánulos celulares y comienzan a degradar las proteínas en toda la célula y la matriz extracelular, destruyendo así la estructura de la célula. La fijación evita dicha degradación inhibiendo directamente la capacidad de estas enzimas para digerir proteínas y haciendo irreconocibles los sitios de escisión de las enzimas.

    Los dos principales mecanismos de fijación son la reticulación y la coagulación. La reticulación implica la formación de enlaces covalentes tanto dentro de las proteínas como entre ellas, lo que hace que el tejido se endurezca y, por lo tanto, resista la degradación. La coagulación es causada por la deshidratación de proteínas mediante el uso de alcoholes o acetona, que deforman la estructura terciaria de la proteína, de modo que las regiones hidrófobas o temerosas del agua mueven la superficie de la proteína. La fijación coagulante puede ayudar a que los medios de inclusión, como la cera de parafina, penetren en el tejido.

    Uno de los fijadores más utilizados es la formalina, que es formaldehído disuelto en agua. Durante la fijación, el formaldehído se adhiere a las aminas primarias, como las que se encuentran en las cadenas laterales de los aminoácidos lisina y glutamina para formar una reticulación estable llamada puente de metileno. Este proceso es intrínsecamente lento y puede tardar entre 1 y 2 días.

    Antes de la fijación, se deben hacer algunas consideraciones. Primero, considere la difusividad de la muestra. Los fijadores difundirán una distancia a través de los tejidos a una velocidad relacionada con el coeficiente de difusión del fijador multiplicado por la raíz cuadrada del tiempo. Un fijador que tarda 1 hora en penetrar 1 mm en la muestra tardará 25 horas en penetrar 5 mm. Una vez que la formalina ha alcanzado el centro del tejido, es necesario que se produzca la reacción de reticulación. Por lo tanto, el tamaño de la muestra debe limitarse a 4 mm de espesor para una fijación completa en un período de tiempo razonable.

    En segundo lugar, considere el volumen y el pH del fijador. La relación de fijador a volumen de muestra debe ser de al menos 40: 1 para que el reactivo no se agote fácilmente con el tiempo. Si bien algunos fijadores están diseñados para funcionar a un pH ácido, la formalina funciona mejor cuando se tampona con fosfato para mantener un pH neutro, de modo que no se produzca un exceso de ácido, lo que provoca artefactos en los tejidos.

    El siguiente paso en la preparación histológica es la incrustación, que implica el soporte de las muestras en un medio que tiene una rigidez mecánica similar a la muestra en sí. La elección del medio de inclusión adecuado es fundamental, ya que si es demasiado rígido o demasiado débil, pueden producirse defectos durante el corte. Con mucho, el medio más común utilizado para la incrustación es la cera de parafina.

    Antes de la inclusión en parafina, las muestras deben deshidratarse reemplazando el agua del tejido con etanol, primero, seguido de xilenos y, finalmente, cera de parafina calentada. Una vez que la cera se ha infiltrado en la muestra, se coloca cuidadosamente y se rodea con cera adicional utilizando un molde para formar un bloque. A continuación, las muestras se unen a un casete de tejido para su corte.

    El seccionamiento es el proceso de cortar rodajas finas de una muestra de un bloque de incrustación. Las secciones suelen tener un grosor del orden de 4-10 & # 181 m para su uso con microscopía óptica.

    Para cortar secciones, primero se fija un disco de metal, vidrio o diamante en un micrótomo. Luego, la muestra se coloca en un portamuestras. A continuación, la muestra se avanza a la superficie de corte y se dibuja a través de la hoja para crear una rebanada del grosor deseado. Las secciones se acumularán como cintas delgadas que se pueden colocar en portaobjetos de vidrio.

    Después del corte, las muestras se colocan en portaobjetos. Para las muestras incluidas en parafina, las rodajas se colocan primero en un baño de agua tibia y luego se sacan del agua sobre el portaobjetos y se dejan secar.

    El tejido biológico tiene muy poco contraste inherente, por lo que después de la histología, los portaobjetos generalmente se tiñen con tintes o anticuerpos que resaltan la morfología o proteínas específicas. La tinción más común realizada es hematoxilina y eosina, o H & ampE. Debido a que es tan común, se han fabricado muchas máquinas automáticas para teñir de manera reproducible numerosas secciones con H & ampE. La hematoxilina tiñe los núcleos de las células de azul y la eosina tiñe el citoplasma de rosa, revelando la morfología celular de los tejidos.

    Un inconveniente de la fijación es que la reticulación de las proteínas puede hacer que los anticuerpos de marcaje encuentren más sus sitios de unión. En lugar de utilizar la fijación para preservar las muestras, se puede utilizar la congelación rápida del tejido o la congelación instantánea, seguida de una técnica de corte llamada criosección.

    Las muestras de tejido se incrustan y orientan en un medio de congelación especial llamado OCT, o medio de temperatura de corte óptima y luego se congelan rápidamente. Como otros medios de inclusión, OCT iguala la rigidez de la muestra.

    Se utiliza un criomicrótomo o criostato para cortar secciones congeladas y este instrumento mantiene una temperatura interna de -20 ° C para mantener frías la cuchilla de corte y las muestras. A diferencia de las secciones incluidas en parafina, las secciones congeladas se pueden levantar directamente sobre un portaobjetos de vidrio cargado positivamente inmediatamente después de la sección.

    Otra forma de evitar la fijación es mediante la inclusión en agar, en el que las muestras se cubren con agarosa líquida recién preparada. A medida que la agarosa se enfría, bloquea el tejido en su lugar y se puede recortar el exceso de agarosa.

    Los vibrotomos, otra alternativa al microtomo, tienen una cuchilla que vibra y se mueve a través de la muestra incrustada en agarosa. Los vibrotomos se utilizan para crear secciones gruesas del orden de 50-1000 & # 181m a partir de muestras incrustadas en agarosa.

    Por lo general, las muestras se extraen de la agarosa antes de la tinción y luego se colocan en un portaobjetos rodeado por una sustancia, como grasa de vacío, que evita que el cubreobjetos aplaste la muestra. Se ven mejor con microscopía confocal para obtener imágenes de alta resolución de cada sección gruesa.

    Acaba de ver el video de JoVE & rsquos sobre la preparación de muestras histológicas para microscopía óptica.

    Ahora debe comprender los pasos necesarios para la preparación de la muestra para pasar de un trozo de tejido a una sección que se puede teñir. Como siempre, gracias por ver!


    Dos métodos para establecer células primarias del estroma endometrial humano a partir de muestras de histerectomía

    El establecimiento de sistemas primarios de cultivo de células del estroma endometrial a partir de muestras de histerectomía es una técnica biológica valiosa y un paso crucial antes de perseguir una amplia gama de objetivos de investigación. Aquí, describimos dos métodos utilizados para establecer cultivos estromales de tejidos endometriales resecados quirúrgicamente de pacientes humanos. & # 160

    Abstracto

    Se han dedicado muchos esfuerzos a establecer in vitro sistemas de cultivo celular. Estos sistemas están diseñados para modelar una gran cantidad de en vivo Procesos. Los sistemas de cultivo celular que surgen de muestras de endometrio humano no son una excepción. Las aplicaciones van desde procesos fisiológicos cíclicos normales hasta patologías endometriales como cánceres ginecológicos, enfermedades infecciosas y deficiencias reproductivas. Aquí, proporcionamos dos métodos para establecer células estromales endometriales primarias a partir de muestras de histerectomía endometrial resecadas quirúrgicamente. El primer método se denomina & # 8220 el método de raspado & # 8221 e incorpora el raspado mecánico con cuchillas quirúrgicas o de afeitar, mientras que el segundo método se denomina & # 8220 el método de la tripsina & # 8221. Este último método utiliza la actividad enzimática de la tripsina para promover la separación de células y excrecencia de células primarias. Ilustramos la metodología paso a paso a través de imágenes digitales y microscopía. También proporcionamos ejemplos para validar líneas de células del estroma endometrial mediante reacciones cuantitativas en cadena de la polimerasa en tiempo real (qPCR) e inmunofluorescencia (IF).

    Introducción

    El cuerpo del útero humano se compone de tres capas, el perimetrio (o serosa), el miometrio y el endometrio. Distinguir cada una de estas capas es un paso importante para establecer líneas de células endometriales. El perimetrio es la capa más externa del útero y está compuesto por células serosas delgadas. El miometrio es la capa media y gruesa del útero y se compone de células de músculo liso. El endometrio se identifica como la capa interna del útero e incluye poblaciones de células epiteliales y estromales.

    El endometrio se subdivide en la capa basal cuya población de células madre se supone que repobla la capa funcional aproximadamente cada 28 días & # 160 1. La capa funcional del endometrio humano sufre cambios bioquímicos y morfológicos significativos en respuesta a las hormonas circulantes. Estas hormonas se derivan de la glándula pituitaria y los ovarios.

    La producción y liberación coordinada de hormonas da como resultado un ciclo reproductivo. El ciclo reproductivo está diseñado para preparar el endometrio para posibles eventos de implantación de embriones. En los seres humanos, el ciclo reproductivo se conoce como & # 8220el ciclo menstrual & # 8221 y se divide en tres fases & # 8211: proliferativo, secretor y menstrual. La fase proliferativa implica la proliferación de la capa endometrial funcional mientras que la fase secretora está marcada por la maduración funcional. Específicamente, las alteraciones extracelulares, las secreciones y la diferenciación celular señalan una posible implantación. Si la implantación no ocurre antes del final de la fase secretora, la capa funcional del endometrio se desprende durante la fase menstrual. Todavía se debate la importancia de la menstruación y los eventos que desencadenan el desprendimiento de la capa funcional. En los seres humanos, se ha planteado que la menstruación es el resultado de un evento específico de diferenciación de la fase media secretora conocido como & # 8220 decidualización espontánea & # 8221 & # 160 2. En este manuscrito, proporcionamos una metodología detallada para ambos métodos de aislamiento de células del estroma endometrial y utilizamos una combinación de inmunofluorescencia e imágenes digitales para demostrar la eficacia de estos enfoques. Además, aplicamos un in vitro modelo de decidualización espontánea para confirmar el aislamiento de las células del estroma endometrial.

    Se requiere suscripción. Recomiende JoVE a su bibliotecario.

    Protocolo

    Las muestras de histerectomía utilizadas en este manuscrito se recolectaron de acuerdo con un protocolo de ética aprobado por el IRB de la Universidad con el número IRB-HSR # 14424.

    1. Adquisición de muestras de fuentes clínicas

    1. Obtenga las pautas éticas gubernamentales e institucionales y la documentación de aprobación antes de comenzar.
    2. Realice todos los pasos en condiciones estériles.
    3. Conserve el tejido derivado del paciente en medio (RPMI o DMEM / glucosa alta) en un tubo de 50 ml a 4 ° C y 176 ° C si la muestra no puede procesarse en cultivo inmediatamente. Las muestras se pueden almacenar en este estado durante un máximo de 24 horas.
    4. Lave la muestra de tejido tres veces con solución salina tamponada con fosfato estéril (PBS) 1X y deseche la solución entre lavados.

    2. Preparación de líneas celulares primarias mediante el método de raspado

    1. Agregue 4-10 ml de medio de crecimiento (RPMI o DMEM / glucosa alta complementada con suero bovino fetal al 10% y penicilina-estreptomicina al 1%) al tejido y agregue Fungizona (concentración final de 0,25 y 181 g / ml) durante 30 min.
    2. Deseche los medios de cultivo.
    3. Lave el tejido dos veces con 1X PBS.
    4. Coloque el tejido en una placa de cultivo celular de 6 cm para distinguir entre las capas de miometrio y endometrio (consulte las Figuras 2A-2C para obtener una descripción más detallada). Separe el endometrio.
    5. Con un bisturí o una hoja de afeitar, corte el tejido en trozos pequeños mientras rasca el plato de cultivo celular de 6 cm. Estos rasguños facilitan la unión de las células endometriales primarias emergentes. En comparación con el método de la tripsina, se necesita más tejido (vea la Figura 2D para una aproximación).
    6. Suavemente, agregue 2 ml de medio de crecimiento a la placa rayada (los fragmentos de tejido serán visibles e idealmente inmovilizados por el movimiento de rascado).
    7. Transfiera la (s) placa (s) a una incubadora de cultivo celular designada (37 & # 176C y 5% CO2). Designe un lugar para las líneas celulares primarias, lejos de otras placas de cultivo celular. Los cultivos primarios son más sensibles a la infección y la contaminación.
    8. Examine las células con un microscopio óptico todos los días. Pequeñas poblaciones de células deben emerger al segundo o tercer día alrededor de los tejidos cortados. (vea la Figura 3B).
    9. Para mantener los cultivos, lave suavemente con 1X PBS y agregue medio de cultivo fresco (2 ml) cada tres días. Cuando aumenta la tasa de proliferación, se pueden agregar medios de crecimiento adicionales (3-4 ml) a la (s) placa (s) de cultivo de 6 cm.
      Nota: Durante el lavado y los cambios de medios, es probable que se aspiren trozos de tejido. Esto no afectará el crecimiento de las células adherentes. Los trozos de tejido deben aspirarse en el paso siguiente (2.10), ya que es poco probable que surjan nuevas colonias después de una semana.
    10. Cuando la placa de 6 cm tiene aproximadamente un 75 - 80% de confluencia (vea la Figura 3B), pase con tripsina al 0,05%. Las células primarias no se pueden pasar indefinidamente: congele una placa de células tan pronto como se mantengan dos o tres placas. Si se requieren más pasajes, siga un protocolo de inmortalización (revisado en Ref 3).

    3. Preparación de líneas celulares primarias utilizando el método de tripsina

    1. Coloque un pequeño trozo de tejido endometrial (vea la Figura 2D para una aproximación) en 2 ml de tripsina al 0,25% suplementado con kanamicina (concentración final 0,03 mg / ml).
    2. Incubar el tejido a 37 ° C y # 176 ° C en una plataforma giratoria durante 30 min.
    3. Agite brevemente el tejido en vórtex.
    4. Centrifugar la muestra a 200-400 x g durante 2 min & # 160 y desechar el sobrenadante.
    5. Agregue tripsina y kanamicina frescas.
    6. Incube el tejido a 37 & # 176C mientras gira durante una hora.
    7. Agite el tejido en vórtex durante 5-10 segundos.
    8. Agregue 2 ml de medio de crecimiento (complementado con suero bovino fetal al 10% y penicilina-estreptomicina al 1%) para desactivar la tripsina.
    9. Centrifugar las células a 200-400 x g durante 2-3 min.
    10. Deseche el sobrenadante y agregue 2 ml de medio de crecimiento a las células sedimentadas.
    11. Coloque en una placa de cultivo celular de 6 cm. Raspando la placa como en el Paso 2.5 de Preparación de líneas celulares primarias mediante el método de raspado no es necesario, pero mejora el apego y el crecimiento de las culturas primarias.
    12. Monitoree las células con un microscopio óptico todos los días. Las células suelen ser visibles bajo un microscopio óptico después de 24-48 horas & # 160(vea la Figura 3C).
    13. Para mantener los cultivos, controle las células y cambie los medios cada 2-3 días como en el Paso 2.9.
    14. Para pasar las células, utilice tripsina al 0,05% o al 0,25% cuando las células alcancen una confluencia del 75-80% (vea la Figura 3C).

    4. Ahorro de tejido adicional para análisis (congelación rápida y fijación con formalina)

    1. Lavar la muestra dos veces con 1X PBS.
    2. Aspire la mayor cantidad de líquido posible.
    3. Para la congelación rápida, coloque la muestra de tejido endometrial en un tubo de centrífuga de 1,7 (ver Figuras 2F y 2G). Coloque el tubo de centrífuga 1.7 en nitrógeno líquido durante 10 segundos o hasta que se pueda ver que el tejido se ha congelado.
      Nota: Tenga cuidado de no tocar directamente el nitrógeno líquido al preparar las muestras. Las muestras se pueden almacenar a -80 ° C y # 176 ° C hasta su posterior procesamiento o análisis.
    4. Para la fijación con formalina, corte un pequeño trozo de tejido endometrial (ver Figura 2H)y sumergir en formalina de zinc tamponada al 10%. Después de 24 horas, deseche la formalina y agregue etanol al 70% a las muestras de tejido hasta su posterior procesamiento.
    1. Fijación celular
      1. Prepare las células en un portaobjetos o placa de cultivo.
      2. Suavemente, lave las células con 1X PBS.
      3. Agregue metanol y acetona preenfriados (4 & # 176C) (mezclados en una proporción de 1: 1) durante 5 min.
      4. Seque el portaobjetos al aire antes de continuar. El portaobjetos se puede almacenar a 4 ° C y # 176 ° C durante 1 a 2 semanas si es necesario.
      1. Rehidratar las células con 1X PBS durante 10 min. Para los siguientes pasos 1-6, realice todos los lavados e incubaciones en una plataforma giratoria.
      2. Bloquear usando 1X PBS suplementado con 1% de albúmina de suero bovino (BSA) y 1% de suero específico de especie (fuente de segundo anticuerpo) durante 30 min & # 160 a temperatura ambiente (RT).
      3. Incube en el anticuerpo primario (consulte las recomendaciones de los fabricantes para conocer las diluciones de anticuerpos). Referirse a Materiales para anticuerpos específicos. Diluir el anticuerpo primario en tampón de bloqueo fresco como en el Paso 5.2.2. Esta incubación se puede realizar durante al menos 2 horas a temperatura ambiente o durante la noche a 4ºC.
      4. Lavar 3 veces con 1X PBS durante 5 min & # 160 cada una.
      5. Incubar en anticuerpo secundario (consulte las recomendaciones de los fabricantes para conocer las diluciones de anticuerpos). Diluir el anticuerpo secundario en tampón de bloqueo fresco como en el Paso 5.2.2. Para evitar el foto-blanqueamiento, es importante realizar este y los pasos posteriores en ausencia de luz.
      6. Lavar 3 veces con 1X PBS durante 5 min & # 160 cada una.
      7. Seque bien los portaobjetos.
      8. Agregue medios de montaje y solución de contratinción DAPI.
      9. Aplique cubreobjetos y selle los bordes con sellador (es). Los portaobjetos se pueden almacenar a 4 ° C y 176 ° C en la oscuridad hasta por 2 semanas.
      1. Pellet 1 x 107 células por centrifugación. Todos los materiales y reactivos de este protocolo deben estar libres de ARNasa.
      2. Lisar las células en 1 ml de reactivo TRIZOL e incubar las muestras homogeneizadas durante 10 minutos a temperatura ambiente para completar la disociación de los complejos de nucleoproteínas.
      3. Añada 200 & # 181l de cloroformo por 1 ml de TRIZOL. Agite vigorosamente a mano durante 15 segundos e incube durante 2-3 minutos a temperatura ambiente.
      4. Centrifugue a velocidad máxima (15.000 x g) durante 15 min & # 160 a 4 & # 176C. El resultado son tres capas.
      5. Transfiera la fase acuosa superior a un tubo de microcentrífuga nuevo. Agregue 1 & # 181l de glucógeno para aumentar el rendimiento de ARN; sin embargo, este paso solo es necesario cuando se prevé una pequeña cantidad de ARN.
      6. Añada 0,5 ml de alcohol isopropílico a la capa acuosa e invierta las muestras 3-5 veces. Incubar las muestras a temperatura ambiente durante 10 min. Para aumentar el rendimiento, las muestras se pueden colocar en -20 & # 176C o -80 & # 176C durante 30 min.
      7. Centrifugue a velocidad máxima durante 10 min & # 160 a 4 & # 176C.
      8. En este punto, debería ser visible un pequeño sedimento de ARN. Deseche el sobrenadante.
      9. Lavar el ARN con 1 ml de etanol al 75%.
      10. Centrifugar a velocidad máxima durante 5 minutos y desechar el sobrenadante. Las muestras se pueden lavar una vez más para eliminar los contaminantes inorgánicos, pero este paso no es necesario.
      11. Brevemente, seque el sedimento de ARN hasta que el sedimento de ARN esté seco (generalmente toma de 7 a 10 minutos).
        Nota: Se puede usar un paso adicional para disminuir la materia inorgánica y disminuir el tiempo de secado. Después de descartar el sobrenadante del lavado con etanol, centrifugar las muestras a velocidad máxima durante un minuto más y aspirar el líquido residual. Tenga cuidado de no aspirar el pellet.
      12. Disuelva el ARN en agua libre de ARNasa, según el tamaño del sedimento de ARN. Los volúmenes normalmente oscilan entre 10-50 & # 181l.
      13. Incubar las muestras a 55 ° C y 176 ° C durante 10 min y medir la concentración de ARN.
      14. Almacene las muestras a -20 & # 176C hasta su posterior procesamiento.
      1. Lleve la muestra de ARN (1-3 & # 181g) a un volumen de 9 & # 181l con H2O.
      2. Calentar el ARN a 70 ° C y 176 ° C durante 10 min.
      3. Para generar una mezcla maestra AMV, combine los siguientes reactivos: 5 & # 181l de dNTP (concentración de trabajo de 50 & # 181M), 5 & # 181l de oligos de ADN N6 (concentración de trabajo de 80 & # 181M), 5 & # 181l de búfer AMV 5X y 1 & # 181l de AMV. Esta solución de mezcla maestra está diseñada para una muestra.
      4. Agregue 16 & # 181l de la mezcla maestra al ARN calentado. El volumen de reacción final será de 25 mu l de reacción.
      5. Utilice las siguientes condiciones de PCR para la transcripción inversa: (Etapa 1) 42 & # 176C durante 90 min, (Etapa 2) 95 & # 176C durante 5 min y (Etapa 3) 4 & # 176C hasta su posterior procesamiento.
      1. Realice reacciones de PCR utilizando los cebadores, las temperaturas de hibridación, los números de ciclo y los reactivos que se encuentran en tabla 1.
        Nota: Es ideal seguir las instrucciones del fabricante al utilizar reactivos de PCR (consulte los números de catálogo y de la empresa en Materiales).

      9. In vitro Protocolo de Decidualización (Derivado de Ref 4 y 5)

      1. Placa de células endometriales.
      2. Crezca hasta una confluencia del 75-85%.
      3. Después de que las células se vuelvan confluentes, lavar una vez con 1X PBS.
      4. Agregue rápidamente medios sin hormonas (RPMI sin fenol complementado con 5% de tira de carbón FBS y 1% de penicilina-estreptomicina).
      5. Después de 24 h, agregue medio libre de hormonas suplementado con acetato de medroxiprogesterona (MPA) a una concentración final de 1 & # 181M y 8-bromoadenosina 3 & # 39,5 & # 39-monofosfato cíclico (cAMP) a una concentración final de 0,5 mM.
      6. Después de al menos 48 horas, detenga la reacción y guarde las placas para su procesamiento posterior.

      Se requiere suscripción. Recomiende JoVE a su bibliotecario.

      Resultados representativos

      Como se enfatiza en el Protocolo sección, asegúrese de llevar a cabo todos los métodos según las pautas gubernamentales, institucionales y éticas al manipular y preparar tejido humano.

      En este manuscrito se incluye una ilustración del flujo de trabajo general del "método de raspado" (Figura 1A) y "el método de la tripsina" (Figura 1B) utilizado para establecer cultivos endometriales primarios. Estos métodos se describen en detalle en la Protocolo sección (ver partes & # 1601. - 3.). Ambos métodos tienen éxito en el crecimiento de cultivos primarios de endometrio. La ventaja del "método de raspado" es el tiempo de preparación más corto; sin embargo, el tiempo que se tarda en observar células viables suele ser de 2 a 4 veces mayor en comparación con el "método de la tripsina".

      Se proporcionan imágenes digitales del tejido humano inicial recibidas de la obtención de tejido. Las capas uterinas se pueden distinguir por la aspereza de la capa, es decir. el miometrio es grueso y musculoso y el endometrio es delgado y más flexible. Hemos resaltado la capa gruesa de músculo liso (miometrio) en blanco y delineado la capa endometrial de interés en negro de dos muestras de histerectomía diferentes (Figuras 2A y 2B). En Figura 2C, los tejidos se orientan con el miometrio hacia arriba mientras que el endometrio se coloca hacia abajo. La fina capa perimetrial se resecó quirúrgicamente y no se destacó en estas imágenes. También es importante tener en cuenta que el tamaño de la capa endometrial en estas imágenes digitales bidimensionales está mal representado, ya que la capa tridimensional real es muy delgada en comparación con el miometrio.

      Cortar el tamaño de tejido apropiado es importante tanto para el "método de raspado" como para el "método de la tripsina". En Figura 2D, se designan tamaños apropiados para cada método por encima de la muestra respectiva. El uso de una pieza de 0,5 x 0,5 x 0,5 cm para "el método de la tripsina" [izquierda] es suficiente para establecer un cultivo. El tejido inicial representativo del "método de raspado" [derecha] incluye todas las capas uterinas. El producto final para "el método de raspado" se representa en Figura 2E, y se recomienda utilizar al menos 1x1x1 cm de tejido endometrial para establecer cultivos viables. El requisito de tanta muestra de tejido es una desventaja del "método de raspado".

      El tejido restante se usa a menudo de numerosas formas, incluidos análisis de proteínas y ARN. Para garantizar la preservación de la calidad del tejido, es importante utilizar un método de "congelación instantánea" como en el Protocolo sección (ver 4.). Este método también se ilustra en Figura 2F y Figura 2G. El ahorro de tejido adicional mediante la fijación con formalina también es una práctica común de patólogos e investigadores. La preparación del tejido para la fijación con formalina se describe en la Protocolo sección (ver 4.) e ilustrado en Figura 2H.

      La microscopía óptica es esencial para monitorear cultivos endometriales primarios. Las células del estroma endometrial individuales deben exhibir morfología de fibroblastos (Figura 3A). El "método de raspado" generalmente genera grupos de células emergentes tempranas, principalmente a lo largo de los rasguños inducidos por el bisturí (Figura 3B, Dia 2). El "método de la tripsina" genera patrones de crecimiento celular tanto en racimos como dispersos (Figura 3C, Día 4). Hemos incluido varias imágenes representativas desde el plateado inicial (día 0) hasta el primer paso de cada método (Figura 3B y 3C).

      Muchos tejidos se definen por su expresión de marcadores específicos de tejido como la actina del músculo liso (SMA) para el músculo liso, CD34 para las células madre inmunes, etc. Aunque se han realizado experimentos de expresión de genes y proteínas para el endometrio & # 160 6-11, aún no se ha descubierto un marcador específico de células del estroma endometrial. En cambio, los investigadores suelen evaluar la pureza del estroma endometrial midiendo los marcadores de posibles contaminantes celulares. Por ejemplo, los marcadores de citoqueratina se utilizan para mostrar poblaciones epiteliales. Sin embargo, es menos preocupante, porque el establecimiento y el mantenimiento del epitelio endometrial son difíciles y, por lo general, se seleccionan en contra (Ref 12 y Figura 4A). Si se obtuvieran muestras durante el embarazo, la expresión positiva de HLA-A, -B, -C demuestra células germinales, trofoblásticas & # 160 13. Por otro lado, al igual que otros fibroblastos mesenquimales, las células del estroma endometrial expresan vimentina (CDH1). Demostramos con inmunofluorescencia, la expresión de vimentina y la ausencia de citoqueratina y cadherina E (CDH1) en nuestras células estromales endometriales establecidas (Figura 4B).

      Finalmente, proporcionamos evidencia funcional de cultivo primario de endometrio a través de un in vitro ensayo de decidualización espontánea. Este método fue adaptado de Ref 4 & # 160 y # 5, e implica el tratamiento de cultivos con una combinación de acetato de medroxiprogesterona (MPA) y 8-bromoadenosina 3 & # 8217,5 & # 8217-monofosfato cíclico (cAMP) (descrito en 9. In vitro Protocolo de Decidualización y modelado en Figura 5A). En presencia de MPA y cAMP, las células del estroma endometrial exhiben perfiles de expresión génica significativamente alterados (revisado en Ref & # 160 14). Los marcadores de decidualización espontánea que se publican con frecuencia son Prolactina (PRL) y Proteína de unión al factor de crecimiento similar a la insulina 1 (IGFBP1) (revisado en Ref 14). La respuesta de estos dos genes al MPA y al cAMP son fuertes indicadores tanto de la decidualización espontánea como del establecimiento exitoso de un cultivo del estroma endometrial. Demostramos esto en Figura 5B.


      Figura 1. Esquema de los dos métodos primarios de aislamiento endometrial. (A) Los pasos 2.1-2.10 del método de raspado se muestran en un organigrama. (B) Los pasos 3.1-3.14 del método de la tripsina se muestran en un organigrama. Haz click aquí para ver una imagen más grande.


      Figura 2. Procesamiento de tejido uterino. (C.A) Muestras clínicas de útero de dos pacientes femeninas. A y # 38 C se derivan del Paciente 1 y B se deriva de la Paciente 2. Tejido uterino resecado quirúrgicamente (izquierda) y capas uterinas resaltadas (Derecha). (A y # 38 B) El miometrio está encerrado en un círculo en blanco y el endometrio en negro. (C) El miometrio está frente a la cámara. (D) Se indican los tamaños de muestra de endometrio representativos iniciales para ambos métodos de aislamiento. El método de la tripsina requiere endometrio puro antes de la adición de la tripsina, mientras que el método de raspado puede utilizar todas las muestras uterinas. (MI) Ejemplo de muestra endometrial procesada del método de raspado. (F y # 38 G) Imagen del tejido uterino restante en preparación para la congelación instantánea. Se muestra un recipiente de metal hecho en laboratorio utilizado para este método. (H) Fijación con formalina de una muestra de endometrio. Haz click aquí para ver una imagen más grande.


      Figura 3. Imágenes de microscopía óptica de cultivos primarios de endometrio. (A) Imágenes representativas de cultivos de células del estroma endometrial tomadas en varios poderes y confluencia. (B) Imágenes representativas del método de raspado (Días 0 - 16) tomadas del mismo plato de cultivo, potenciado a 10x. Nota: Las líneas visuales indican rasguños de la hoja quirúrgica. (C) Imágenes representativas del método de tripsina (días 0 - 16) tomadas del mismo plato de cultivo, potenciado a 10x. Haz click aquí para ver una imagen más grande.


      Figura 4. Imágenes de inmunofluorescencia de células del estroma endometrial. (A) Inmunofluorescencia de cultivos primarios de endometrio aislados mediante el método de raspado. Las imágenes demuestran la pérdida de citoqueratina entre el paso 2 (P2) y el paso 5 (P5). Se utilizaron como controles la proteína nuclear de la proteína de leucemia promielocítica (PML) y la tinción con DAPI. (B) Las imágenes demuestran tinción positiva para el marcador mesenquimatoso Vimentina. Las imágenes también muestran tinción negativa para cadherina E (CDH1) y citoqueratina. Se proporcionaron tinciones para DAPI y proteína de leucemia promielocítica (PML) como controles. Haz click aquí para ver una imagen más grande.


      Figura 5. Decidualización espontánea de dos células estromales endometriales primarias. (A) Esquema del procedimiento experimental. (B) Regulación al alza de la expresión génica de prolactina (PRL) y proteína de unión al factor de crecimiento similar a insulina 1 (IGFBP1) en respuesta a MPA y cAMP. Los resultados se midieron mediante RT-qPCR y la expresión se normalizó a GAPDH. La significancia se calculó utilizando la prueba t de Student (P & # 60 0,001 *** y P & # 60 0,0001 ****). Ambas líneas celulares se aislaron usando el método de raspado. Haz click aquí para ver una imagen más grande.

      Cebador Secuencia Temperatura de recocido (& # 176C) Ciclos Ensayo
      Prolactina (PRL) Adelante CATATTGCGATCCTGGAATGAGC 60 40 Sybrgreen
      Prolactina (PRL) inversa TCCTCAATCTCTACAGCTTTGGA 60 40 Sybrgreen
      Proteína de unión al factor de crecimiento similar a la insulina 1 (IGFBP1) Adelante TCCTTTGGGACGCCATCAGTAC 60 40 Sybrgreen
      Proteína 1 de unión al factor de crecimiento similar a la insulina (IGFBP1) Reversa GATGTCTCCTGTGCCTTGGCTA 60 40 Sybrgreen
      GAPDH Sin especificar (ver lista de reactivos) 60 40 Taqman

      Tabla 1. Condiciones de PCR para marcadores de decidualización.

      Se requiere suscripción. Recomiende JoVE a su bibliotecario.

      Discusión

      Otros grupos han descrito y adaptado la metodología para la preparación de cultivos del estroma endometrial, la mayoría de los cuales utilizan colagenasa & # 160 4,12,13,15-18. En este manuscrito, hemos proporcionado la metodología y la evidencia para dos métodos de cultivo del estroma endometrial primario simplificados, los cuales son utilizados por nuestro laboratorio por razones económicas y la disponibilidad conveniente de tripsina y / o una hoja de afeitar.

      Al comparar nuestros dos métodos, ambos generan exitosamente cultivos primarios viables. Nuestro método preferido es el método de la tripsina, ya que normalmente hay un mayor rendimiento con un requisito de tamaño de muestra más pequeño. Sin embargo, si el tiempo de preparación es limitado, el método de raspado requiere 30 minutos, mientras que la siembra en placa de células con el método de tripsina lleva más de una hora y media.

      También es digno de mención que demostramos estos métodos con muestras de histerectomía en lugar de biopsias endometriales. Las biopsias endometriales se toman sin una intrusión significativa y tienden a producir muestras más pequeñas. Aún así, los métodos descritos en este manuscrito (especialmente el método de la tripsina) deberían producir cultivos de biopsias endometriales.

      Existen numerosas aplicaciones para las células estromales del endometrio primarias. La comparación de cultivos de estroma endometrial de humanos con otros mamíferos puede proporcionar pistas sobre las preguntas que se han debatido durante siglos sobre por qué los humanos menstrúan. Hay otros estudios de fisiología inexplorados que requieren in vitro cultura. De particular interés son los descubrimientos que brindan información sobre los eventos del ciclo reproductivo, como los hallazgos que han relacionado los eventos moleculares epigenéticos con los eventos funcionales del ciclo reproductivo & # 160 19,20, 21, y revisados ​​en Ref & # 160 11.

      Los médicos se beneficiarían enormemente del estudio del cultivo del estroma endometrial y de la identificación de biomarcadores en los casos de trastornos reproductivos y neoplasias malignas del cáncer. Entre 2006 y 2010, se informó que 7,4 millones de mujeres y sus parejas utilizaron servicios de infertilidad en los Estados Unidos & # 160 22. Un porcentaje significativo de infertilidad se debe al fracaso de la decidualización & # 160 23. Además, la relación entre las enfermedades del endometrio, como la hiperplasia y la endometriosis, con la infertilidad sólo se está evaluando recientemente. La capacidad de estudiar los cánceres ginecológicos de útero a través de in vitro El modelado también es invaluable porque aunque el sarcoma endometrial avanzado es raro, puede ser letal. Estableciendo in vitro cultivos primarios, estudiamos el impacto de los eventos moleculares asociados a las enfermedades y pueden generar aplicaciones clínicas putativas.

      En conclusión, generando representativos y eficaces en vivo modelos para muchas de estas aplicaciones es difícil. Esto hace que el desarrollo de in vitro Cultivos primarios de endometrio para estudiar varios en vivo funciones críticas. Estos dos métodos de aislamiento endometrial, & # 8220 el método de raspado & # 8221 y & # 8220 el método de la tripsina, & # 8221 ayudarán a proporcionar el punto de apoyo para nuestra comprensión de la fisiología y patología endometrial. & # 160 & # 160.

      Se requiere suscripción. Recomiende JoVE a su bibliotecario.

      Divulgaciones

      Los autores no tienen nada que revelar.

      Expresiones de gratitud

      Agradecemos los esfuerzos de colaboración de la Dra. Thao Dang y los miembros de su laboratorio por el uso de sus equipos de microscopía y de imágenes. También agradecemos al núcleo del Centro de Investigación de Tejidos y Biorepositorios (BTRF), Jeff Harper, y a los residentes de la Universidad de Virginia por proporcionarnos tejido uterino. Agradecemos a Karol Szlachta por la ayuda con Schematic Overview.


      ORGANIZACIÓN Y LOGÍSTICA DEL PROGRAMA DE AUTOPSIA RÁPIDA

      Los programas de autopsia rápida son estructuras logísticamente complicadas y laboriosas, por lo que la clave del éxito es la flexibilidad del programa y el mantenimiento de un enfoque multidisciplinario. La flexibilidad es importante para crear el equipo apropiado para un entorno de programa específico y un conjunto de objetivos de investigación. Muchos programas están disponibles las 24 horas del día, los 7 días de la semana, a menudo con al menos 2 equipos rotativos que cubren 1 o varios turnos de semana. Sin embargo, los programas exitosos también pueden ser ejecutados por un solo equipo que está de guardia durante un número restringido de horas todos los días. Estos programas suelen estar dirigidos por patólogos u oncólogos, aunque el trabajo integrado entre las 2 subespecialidades y específicamente entre médicos e investigadores siempre es crucial para que los programas prosperen a largo plazo. dieciséis

      Pasos activos para implementar un RAP

      Las colaboraciones exitosas en las complejas relaciones entre médicos e investigadores se pueden dividir en una serie de pasos de acción que se muestran en la Figura & # x200B Figura 1. 1. El concepto de utilizar tejido post mórtem y las cantidades potencialmente disponibles de tejido es lo suficientemente nuevo para algunos investigadores que se requiere un pensamiento cuidadoso a priori sobre cómo el RAP encajará en proyectos existentes o creará nuevas vías de investigación (CONSIDERAR). Se deben determinar la población de pacientes y los tipos de muestras. Los intervalos post mórtem (PMI) pueden afectar notablemente la forma en que el tejido se puede utilizar con éxito, y se deben delinear los parámetros para diferentes escenarios de casos (DEFINIR, CUMPLIR). Luego, el RAP debe ser revisado con los posibles participantes y las familias (DISCUTIR), y los documentos legales adecuados deben adquirirse (CONSENTIMIENTO). Los patólogos e investigadores y / u otros científicos que realizan la autopsia rápida deben trabajar en estrecha colaboración antes y en el momento de la recolección (COOPERAR) y durante la evaluación y la investigación posterior (COLABORAR). Por último, los patólogos de autopsias rápidas deben crear un bucle de comunicación sobre los resultados de la investigación, las experiencias familiares y las necesidades cambiantes de los casos (RETROALIMENTACIÓN).

      Planificación y pasos de acción por parte del director e investigador de RAP para una colaboración de autopsia rápida y exitosa.

      El consentimiento del estudio

      Una parte crucial de las actividades previas al caso (antes de la muerte) es el proceso de consentimiento del estudio, en el que el paciente o sus familiares legales más cercanos firman y dan su consentimiento para recolectar y utilizar sus tejidos para futuras investigaciones. El proceso de consentimiento del estudio puede incluir un permiso explícito para un amplio espectro de posibles usos futuros (como secuenciación genética, generación de líneas celulares, banco de tejidos, intercambio de tejido con investigadores de diferentes instituciones, toma de imágenes de casos, recuperación de diapositivas y bloques de biopsias previas y muestras de resección, y la recogida de muestras de sangre premortem). Por supuesto, el paciente puede decidir restringir su consentimiento como prefiera.

      Es extremadamente importante que este consentimiento individualizado se obtenga para muestras post mortem y que esté escrito en términos lo suficientemente generales como para ser utilizado en pacientes con todo tipo de enfermedades. Parece probable que pronto se requiera dicho consentimiento individualizado para las pruebas genéticas y las líneas celulares, incluso en pacientes fallecidos, a medida que las agencias reguladoras se den cuenta del potencial de expansión del tejido post mórtem. Además del consentimiento necesario para el estudio, las autopsias rápidas requieren un consentimiento para el procedimiento de autopsia en sí, al igual que las autopsias de diagnóstico regulares.

      Metas y enfoques de muestreo

      Cada autopsia rápida es una oportunidad poderosa para proporcionar a varios investigadores muchas muestras valiosas al mismo tiempo. Por ejemplo, un solo caso de autopsia rápida puede proporcionar tejido tumoral a investigadores internos, tejido a otras 3 instituciones fuera del estado (incluidos los Institutos Nacionales de Salud) y tejido almacenado para el programa en sí, así como controles normales de cerebro, ojo, pituitaria, corazón, conducto pancreático y músculo esquelético para otros grupos de investigación. Para lograr esto, es imperativo tener protocolos de muestreo preestablecidos que especifiquen los tipos de tejido y el procesamiento necesarios para este tipo de acción multifacética durante un caso. Cada grupo de investigación tiene un representante designado, y estas personas son contactadas como grupo tan pronto como se conoce la muerte del paciente.Los equipos de investigación proporcionan personal suplementario para ayudar en la autopsia, y el alcance y la composición de estos equipos varían según el número de muestras buscadas y el alcance del procesamiento inmediato en el lugar requerido. También puede ser muy útil tomar muestras de cada lesión / tejido normal en paralelo asignando parte de la misma área para recolectarla fresca en medios como RPMI, parte congelada en nitrógeno líquido o congelada gradualmente en OCT y parte fijada con formalina. Los estudios correspondientes que utilizan líneas celulares o xenoinjertos, secuenciación y tinción inmunohistoquímica pueden crear sinergia, lo que ayuda a delinear el & # x0201ciclo de vida & # x0201d de una célula cancerosa. Es importante tener al menos 1 miembro del equipo dedicado exclusivamente al etiquetado y seguimiento de muestras para facilitar este importante muestreo paralelo.

      Tiempo y procesamiento de muestras

      Desde el comienzo del desarrollo de la autopsia rápida, el principio organizativo primordial de todos los RAP ha sido que las muestras u órganos deben extraerse y procesarse lo más rápidamente posible. Con esta prensa para tejido de & # x0201chigh-quality & # x0201d surge la necesidad de determinar los marcadores críticos de calidad para el tejido post mortem humano. 17,18 El PMI se define como el tiempo que transcurre entre el momento de la muerte y el momento en que el tejido se ha colocado en el conservante (ya sea medio para muestras frescas, congelación rápida en nitrógeno líquido o fijación en formalina). Dependiendo del centro y de los aspectos particulares del caso involucrado, el PMI típico puede oscilar entre 0,5 y 23 horas. La calidad del tejido post mórtem puede verse afectada por PMI, condiciones pre mórtem (agónicas) y factores post mórtem (preanalíticos). Tradicionalmente, un PMI bajo ha sido el sello distintivo de la alta calidad del tejido. 19,20

      Aunque el efecto del PMI en el muestreo puede individualizarse en gran medida por tipo de cáncer o enfermedad y el hábito corporal del paciente, algunas pautas generales del PMI para un muestreo exitoso pueden obtenerse de la literatura sobre el tema. Como se muestra en la Figura 2, las muestras frescas con células vivas se recolectan mejor dentro de las 6 a 8 horas posteriores a la muerte. Las muestras para la secuenciación de ARN y ADN pueden congelarse o colocarse en un medio con reactivo estabilizador y, por lo general, es mejor recolectarlas dentro de las 12 horas posteriores a la muerte como máximo. La histología y la inmunohistoquímica seguirán produciendo buenos resultados después de 12 horas de PMI. Sin embargo, el autor ha tenido la experiencia de líneas celulares que crecen a partir de una muestra tomada después de 12 horas cuando el entorno (dentro de un área de hemorragia) era propicio. Los patólogos e investigadores de autopsias rápidas deben discutir juntos qué recolecciones se realizarán si las circunstancias (preocupaciones familiares, clima, tráfico o cualquier otra circunstancia) pudieran extender el PMI más de lo planeado.

      Pautas sugeridas de PMI para la utilización eficaz de muestras de tejido RAP.

      Ejemplos de organizaciones RAP exitosas

      Los diversos enfoques para crear e implementar la compleja logística de un equipo RAP se destacarán en los 4 ejemplos que se analizan a continuación.

      En el Centro Médico de la Universidad de Nebraska, un equipo de investigación rotativo está disponible las 24 horas, los 7 días de la semana, compuesto por 2 técnicos de tiempo completo, con la participación de 3 técnicos de guardia y asistentes de patología. 21 El RAP de la Universidad de Michigan en Ann Arbor consta de 2 equipos, un equipo de autopsia y un equipo de obtención de tejido, que reciben alertas y trabajan juntos durante cada caso, y todos están disponibles las 24 horas del día, los 7 días de la semana. El equipo de autopsias consta de un patólogo genitourinario, un becario de patología genitourinaria, un residente de patología y un asistente de patología. El equipo de obtención de tejidos estaba formado por el oncólogo médico, el personal y los investigadores de posdoctorado, asistentes de laboratorio y un residente de urología. 4 En Weill Cornell, el equipo de RAP está compuesto por un patólogo de autopsias, un residente de patología, un asistente técnico de autopsias y de 2 a 4 miembros adicionales, incluidos patólogos, investigadores postdoctorales y técnicos de investigación que ayudan en la obtención de tejidos y el procesamiento inicial. El equipo también puede incluir a los oncólogos y cirujanos que tratan a los pacientes. 22 El equipo de RAP de Johns Hopkins en Baltimore, Maryland, consta de un patólogo / director de RAP, un coordinador de muestras, un asistente de autopsia / diener para ayudar en la disección y un investigador patólogo de autopsias o instructor, y varios equipos de investigación de cáncer y otras subespecialidades. miembros. El equipo central está disponible los 7 días de la semana durante 15 horas al día.


      Objetivo

      Desarrollar un procedimiento operativo estándar (POE) para la recolección, transporte, almacenamiento de muestras de sangre y tejido endometrial humano, anotación de sujetos y muestras, y establecimiento de prioridades de muestras.

      Diseño

      El SOP sintetiza procedimientos científicos sólidos, la literatura sobre la investigación de la isquemia, la recolección de muestras y la elaboración de perfiles de expresión génica, las buenas prácticas de laboratorio y la experiencia de los autores sobre el flujo de trabajo y la calidad de las muestras.

      Configuración

      Instituto Nacional de Salud, Universidad de California, San Francisco, Banco de ADN y tejido endometrial humano.

      Paciente (s)

      Mujeres sometidas a biopsia endometrial o histerectomía por indicaciones no malignas.

      Intervención (es)

      Recolectar, procesar, almacenar, distribuir tejido endometrial y muestras de sangre según los protocolos de la junta de revisión institucional aprobados y el consentimiento informado por escrito de los sujetos participantes.

      Las principales medidas)

      Procedimiento Operativo Estándar.

      Resultado (s)

      El SOP aborda la anotación de sujetos rigurosa y consistente, el procesamiento y caracterización de muestras, el cumplimiento normativo estricto y una referencia para que los investigadores rastreen los tiempos de recolección y almacenamiento que pueden influir en su investigación.

      Conclusión (es)

      El enfoque integral y sistemático para la obtención de sangre humana y tejido endometrial en este POE asegura la alta calidad, confiabilidad y utilidad científica de bioespecímenes puestos a disposición de los investigadores por los Institutos Nacionales de Salud, Universidad de California, San Francisco, Tejido Endometrial Humano y Banco de ADN. El detalle y la perspectiva de este POE también proporcionan un plan para la implementación de programas de cobranza similares en otras instituciones.


      2 RESULTADOS Y DISCUSIÓN

      2.1 Protocolo de preparación: descripción general y consideraciones generales

      Todo el procedimiento detallado en la sección 3 se resume aquí y se enumera en la Tabla 1. La crioinmovilización de cultivos de células animales mediante congelación rápida a alta presión (congelación a alta presión [HPF] 36, 37) es seguida por FS, eliminación de pesados fijadores de metales y HR de la muestra a temperaturas bajo cero. La postfijación y enjuague posteriores se realizan en hielo. Finalmente, las muestras se someten a permeabilización con detergentes a temperatura ambiente y etiquetado indirecto de inmunogold preincrustado mediante el uso de conjugados NANOGOLD-Fab '.

      Reactivos Tiempo Temperatura
      FS, etc. Sustitución por congelación Acetona + 0,2% UA + 0,5% GA + 0,05% OsO4 + 1% metanol + 5% agua ≈18 h 68 -90 ° C
      Calentamiento hasta -35 ° C Acetona + UA / GA / OsO4 ≈34 h 68 De −90 ° C a −35 ° C
      Incubación a -35 ° C Acetona + UA / GA / OsO4 ≈19 h −35 ° C
      Lavado de metales pesados Acetona + 0,5% GA 4 × 30 min
      Enjuagar Acetona + 0,5% GA 45 min
      Rh Rehidratación # 1 (parcial) 50% acetona + 50% agua + 0,5% GA 10 minutos Sobre hielo
      RH # 2 (parcial) 25% acetona + 75% agua + 0,25% GA 10 minutos
      RH # 3 (completo) Agua + 0,25% GA 5 minutos
      Postfijación Agua + 0,25% GA 120 min
      Enjuagar Agua 3 × 10 min + 4 ° C
      PHEM 3 × 10 min RT
      Almacenamiento PHEM SOBRE + 4 ° C
      LABORATORIO Permeabilización → 3 aclarados PHEM + 0.05% TritonX-100 → PHEM 30 min → 3 x 10 min RT
      Inactivación de aldehídos PHEM +0,05 M de glicina 15 minutos
      Bloqueo PHEM + 5% BSA + 0,1% CWFG 30 minutos
      Enjuagar PHEM + 0,1% BSA-c 3 × 3 min
      Incubación de anticuerpos (AB) AB primario en PHEM + 0.1% BSA-c 180 min
      Enjuagar PHEM + 0,1% BSA-c 6 × 10 min
      Incubación AB AB-Fab'-NANOGOLD secundario en PHEM + 0.1% BSA-c 60 min → O / N → 60 min RT → + 4 ° C → RT
      Enjuagar PHEM + 0,1% BSA-c 3 × 10 min RT
      PHEM 6 × 2 min
      Postfijación PHEM + 2% GA 10 minutos
      Enjuagar PHEM 6 × 5 min
      Aq. dest. 6 × 2 min
      Realce de plata HQ-plata 8 min
      Temple Ácido acético al 1% en Aq. dest. 2 × 1 min
      Enjuagar Aq. dest. 6 × 10 min
      EMB, etc. Postfijación / tinción en bloque 0,5% de OsO4 en Aq. dest. 15 minutos
      Enjuagar Aq. dest. 3 × 10 min
      Postfijación / tinción en bloque 0,2% UA en Aq. dest. SOBRE + 4 ° C
      Enjuagar Aq. dest. 3 × 10 min RT
      Deshidratación con solvente, infiltración de resina, polimerización, microtomía (tinción de sección opcional), EM

      Los conjugados NANOGOLD son marcadores ultrapequeños 3 con un núcleo de oro de solo 1,4 nm, por lo general no reconocibles en el entorno granulado y ruidoso de las células procesadas para EM (excepto con ciertos enfoques de obtención de imágenes EM de alta gama, ver, p. Ej., Ref. 38). Por lo tanto, el tamaño de estas partículas debe aumentarse depositando plata metálica sobre la superficie del oro. Este procedimiento 39, conocido como realce con plata (SE, o autometalografía), se basa en reacciones químicas similares al revelado de películas en blanco y negro y tiene sus propios desafíos y limitaciones, como se analiza a continuación en la sección 2.6. Después de la amplificación autometallográfica de las partículas de oro inmunológico, las muestras se someten a tinción en bloque, inclusión de resina estándar, corte ultrafino o semigrueso y análisis por EM, complementado con reconstrucción tomográfica en 3D.

      2.2 Cultivo celular, crioinmovilización, FS

      Líneas de células epiteliales humanas (CaCo2, HeLa) y fibroblastos embrionarios de ratón (MEF) se cultivaron en membranas de filtro de plástico (CaCo2) o en discos de zafiro recubiertos de carbono. 40, 41 HeLa y MEF formaron monocapas estrictamente planas, no confluentes, CaCo2 creció como monocapas polarizadas confluentes, hasta ≈20 μm de altura. La HPF se realizó como se describió previamente en detalle. 40, 41

      Para FS probamos diferentes medios hechos de acetona más fijadores y tinciones en bloque. Para la HR de muestra posterior (Tabla 1) modificamos los protocolos de los grupos en Utrecht y Tübingen. 22, 23 Todos nuestros medios FS contenían acetato de uranilo (UA), de acuerdo con estudios previos realizados por otros sobre FS-RH 22, 23 que confirmaron el conocido efecto estabilizador de UA sobre los lípidos de membrana. 18, 42-45 Un cóctel FS de acetona más UA (0,2% p / vol), glutaraldehído (GA 0,5% vol / vol), tetróxido de osmio (OsO4 0,05% p / vol), agua (destilación acuosa 5% vol / vol) y metanol (1% vol / vol) dieron consistentemente los mejores resultados. A juzgar por las secciones delgadas estándar de 100 nm, la estructura fina celular de estas muestras FS-RH parecía en general bien conservada (por ejemplo, Figuras 1 y 2AB), bastante similar a las muestras clásicas de FS (por ejemplo, Referencia 40: Figura 1 Ref.41: Figuras 1B y 4G). La tinción posterior de la sección con UA ​​y plomo aumentó el contraste de la muestra, pero no fue obligatorio para visualizar adecuadamente los detalles subcelulares.

      2.3 Inmunogold-EM previo a la incrustación

      El cóctel UA / GA / OsO4 para FS produjo un etiquetado inmunológico adecuado (por ejemplo, Figuras 1 y 2A Figura S1A-C) con una selección decente de anticuerpos probados hasta ahora (enumerados en la sección 3.3). El repertorio de anticuerpos aplicado aquí a células humanas y murinas reconoció proteínas endógenas y marcadas, como conjugados con HA y GFP (hemaglutinina de influenza, proteína verde fluorescente y sus derivados). La comparación con las técnicas establecidas incluyó varios controles metodológicos y biológicos para validar la especificidad del etiquetado (ver la sección 3.6 y la Figura S6), así como estimaciones cuantitativas seleccionadas. La Figura S1 ilustra la detección de la proteína LAMP1 de membrana de endosoma / lisosoma tardía (proteína de membrana asociada a lisosoma-1) por un anticuerpo monoclonal 46 bien caracterizado en una línea MEF descrita previamente. 40, 47 Se obtuvieron patrones de marcado bastante congruentes con 2 variantes de nuestro enfoque de preinclusión criogénica y con IEM de preinclusión convencional o criosección de Tokuyasu.

      Para probar la flexibilidad de nuestro enfoque, también usamos otras combinaciones de reactivos (Figuras S3 y 4), como alternativa a nuestro UA / GA / OsO4 favorito. Un protocolo para FS y RH, por ejemplo, incluía FA en lugar de GA, junto con UA ​​y OsO4. Aquí, la preservación estructural y la intensidad del etiquetado fueron satisfactorias (Figura S3A, B) y, a veces, bastante buenas, aunque el contraste de la muestra fue menor que con el cóctel UA / GA / OsO4. Tales muestras sin GA de células cultivadas en discos de zafiro (cuadriculados) evitan el problema de la autofluorescencia inducida por GA y, por lo tanto, podrían ser útiles para ciertos tipos de microscopía de fluorescencia complementaria y análisis EM. 11, 48, 49 En particular, la mayoría de los anticuerpos probados hasta ahora con nuestro enfoque de preinclusión criogénica eran compatibles con cócteles FS que contenían hasta un 0,05% de OsO4 (en total: 11 de 16). Esto puede parecer sorprendente a primera vista. Sin embargo, nuestros datos son consistentes con algunos informes 18, 34, 50 de que las soluciones de OsO4 altamente diluidas no necesariamente eliminan la antigenicidad o la actividad enzimática, especialmente cuando la osmicación se realiza a bajas temperaturas.

      Finalmente, mezclamos un cóctel FS que contenía simplemente UA y GA como fijadores / tinciones adaptados para anticuerpos que fallaron completamente con muestras tratadas con osmio. La localización de la LC3 endógena, un marcador de autofagia genuino, sirve como ejemplo para esta serie de experimentos. Realizamos IEM preincrustado convencional y basado en crio, así como el etiquetado de criosección de Tokuyasu con un anticuerpo comercial en HeLa (Figuras S3C, S4E-K). De acuerdo con informes de IEM anteriores, 51, 52 LC3 etiqueta ubicada en la membrana interna y externa de orgánulos pleomórficos, morfológicamente interpretados como autofagosomas (Figura S4E), además de su distribución citoplásmica (Figura S3C). Además, los experimentos de control evaluaron el origen autofágico de estos compartimentos, si la unión preferencial de inmunooro-plata observada a los perfiles del núcleo de los orgánulos reflejaba realmente la LC3 endógena. Para ello, analizamos WT y GFP-LC3 HeLa privados de aminoácidos y suero durante 2 horas y tratados con bafilomicina A1 (BafA). La inanición con bloqueo simultáneo del flujo autofágico 53 aumentó claramente el número de estructuras positivas para LC3, como lo revela la microscopía de fluorescencia (Figura S4A-D) y la cuantificación EM (estado estacionario 10,6 ± 1,5 frente a 23 ± 2 orgánulos por cada 100 micrones cuadrados en estado estacionario). ± SEM). Los análisis complementarios de IEM y la cuantificación mostraron que tanto la etiqueta de inmunoold LC3 como GFP-LC3 se concentraban en el núcleo interno de los autofagosomas putativos (Figura S4E-M). En conjunto, estos resultados apoyaron nuestra interpretación ultraestructural y sugirieron fuertemente que la distribución de la etiqueta de inmunoold LC3 endógena sea específica.

      2.4 Imágenes tridimensionales

      Para localizar y modelar la etiqueta de inmunooro en el contexto de la arquitectura 3D de orgánulos, empleamos ET de eje simple y doble con secciones de resina epoxi de 300 a 400 nm de muestras UA / GA / OsO4 o UA / GA. Las tomografías de transmisión EM (TEM) y barrido-TEM (STEM) realizadas con un filamento Lab6 a 200 kV demostraron ser ambas factibles (Figuras 2B-D y 3 Películas S1 y S2). En particular, la presencia o ausencia de OsO4 en los medios FS tuvo solo un impacto menor en la visibilidad de los detalles subcelulares en TEM 2D estándar (por ejemplo, Figura S3C). Sin embargo, en el caso de la tomografía de secciones semi-gruesas, la ausencia de OsO4 en los medios UA / GA resultó en un menor contraste de la muestra y, a su vez, en reconstrucciones menos brillantes. La tinción posterior a la sección con ácido fosfotúngstico etanólico caliente, 54 como se introdujo previamente para la ET de levadura criofijada, 55 no mejoró visiblemente el contraste de estas células de mamífero. Juntos, consideramos las muestras procesadas de acuerdo con el protocolo UA / GA / OsO4, pero también el protocolo UA / GA descrito aquí como adecuadas para la reconstrucción 3D (películas S1 y S2), incluidos enfoques distintos de la tomografía. El fresado con haz de iones enfocado (FIB 56: y nuestros datos no publicados), SEM 57 de cara de bloque en serie) o EM 58 de alto voltaje podrían permitir la reconstrucción de muestras de varios micrones de espesor, como células enteras, un objetivo que no es ( fácilmente) logrado por ET de voltaje intermedio de secciones semi-gruesas de ≈400 nm.

      2.5 Accesibilidad de los reactivos

      La eficacia de penetración de anticuerpos, conjugados NANOGOLD y / o reactivos SE difería entre las células de una muestra dada, independientemente de las condiciones de FS, RH y / o permeabilización. Las células cultivadas en cubreobjetos de zafiro mostraron la correlación esperada entre los patrones de preservación y marcaje: las células aparentemente bien congeladas contenían partículas más pequeñas y menos de plata inmuno-dorada que las células con daño moderado, aunque todavía tolerable, en los cristales de hielo. Por razones desconocidas, esta clara correlación solo fue evidente ocasionalmente en células cultivadas en membranas de filtro. En cualquier caso, no se observaron gradientes intracelulares desde la membrana plasmática hasta la envoltura nuclear; por lo tanto, las densidades de marcaje no variaron considerablemente a lo largo de una población de orgánulos dada dentro de una misma célula.

      Un experimento de etiquetado considerado positivo arrojó alrededor del 30% de las muestras utilizables. Esta estimación aproximada se basa en el examen visual de secciones delgadas de 100 nm mediante TEM estándar. Cada lote de muestras de UA / GA / OsO4 que se procesaron en paralelo (≈8 zafiros o piezas de filtro) mostró cantidades aproximadamente iguales de (1) células adecuadamente conservadas y etiquetadas, (2) (casi) células no etiquetadas y (3) ) células con un fondo de plata-oro inmunológico fuerte e inaceptable en toda la muestra (compare la Figura S5 con todas las demás figuras y figuras complementarias). La cosecha obtenida con los demás protocolos fue variable.

      Nuestros datos indicaron que el etiquetado de preinclusión criogénica podría funcionar principalmente sin ninguna permeabilización adicional de la muestra antes de la incubación del anticuerpo (por ejemplo, Figura S1A-C, G). Obviamente, el crecimiento de cristales de hielo intracelulares (diminutos) durante la congelación, FS y / o RH es la principal causa de, y sirve como base suficiente para el éxito de la EM inmuno-dorada preincrustada de muestras FS-RH criofijadas. Sin embargo, se lograron densidades de marcaje comparativamente más altas con células tratadas con detergente (por ejemplo, Figura S1G). Esta observación nos llevó a evaluar opciones para facilitar la difusión de reactivos en células aparentemente bien congeladas que muestran un citoplasma bien conservado, por lo tanto, presumiblemente bastante impenetrable, pero sin afectar la integridad subcelular. Para ello, expusimos las células a diferentes concentraciones de Triton X-100 (TX-100) o Saponina, o bien a congelar-descongelar antes de la incubación del anticuerpo. En particular, ninguna de estas manipulaciones interfirió visiblemente con la preservación de la ultraestructura de las células FS-RH, ni siquiera la incubación con TX-100 al 0,2%. Esto contrasta fuertemente con los hallazgos de los protocolos estándar. 9 Para la permeabilización de muestras convencionales fijadas con soluciones acuosas de aldehído, la saponina se prefiere ampliamente como detergente "suave" al TX-100 "duro" y más destructivo. 9 Solo se puede especular acerca de las causas de esta divergencia entre IEM preincorporado convencional y criogénico sobre la base de los datos disponibles hasta ahora.Los diferentes modos y acción de la fijación de muestras 59, 60 pueden explicar en parte este fenómeno: la calidad y el alcance de la estabilización de proteínas no son los mismos que los logrados por FS-RH más postfijación acuosa, o por fijación acuosa a temperatura ambiente con diferentes tipos de aldehídos (que de nuevo, difieren en sus propiedades de reticulación 1, 33, 42). La virtud estabilizadora de fosfolípidos de AU 1, 33, 42 es otro factor que posiblemente contribuya de una manera favorable y complementaria a la notable resistencia de nuestras muestras FS-RH a la corrosión inducida por detergentes (nuestros datos no publicados). Este reactivo se incluyó sistemáticamente en todos nuestros medios FS, pero no forma parte de los protocolos convencionales de fijación y preinclusión. En conjunto, consideramos que la permeabilización de detergente adicional no es un requisito previo indispensable para el etiquetado inmunológico de preincrustación de células FS y criofijadas, sino como una opción útil. Nuestro flujo de trabajo estándar incluye, por lo tanto, una exposición de 30 minutos a TX100 a una concentración moderada de 0.05%, similar a los protocolos establecidos 7 para IEM pre-incrustado convencional.

      2.6 Visualización de NANOGOLD

      Como se sabe de cualquier conjugado de oro ultrapequeño sometido a SE, 10, 43, 61, las partículas de plata NANOGOLD generadas aquí variaron en tamaño y forma (por ejemplo, Figuras 1B y 2A), incluidos agregados de varias partículas NANOGOLD dentro de la misma plata cascarón. 10, 43, 61 Para los análisis TEM meramente cualitativos en la heterogeneidad de partículas 2D parece más un problema estético que fundamental. En el mayor volumen de tomogramas, sin embargo, el tamaño y la forma de partícula desigual se vuelven más evidentes (Figuras 2C y 3A) y, a veces, inquietantes. Esto es particularmente cierto para la cuantificación precisa de etiquetas. Además, las pepitas de plata y oro irregulares hechas de acumulaciones intensificadas de NANOGOLD reducen la precisión (es decir, la resolución espacial) de las reconstrucciones 3D de la distribución de antígenos. 10 Otros conjugados de oro con / sin SE posterior (como se usa, por ejemplo, en la Referencia 62) fallaron en nuestras manos, ya que penetraron solo en las células que sufrían daños inaceptables en los cristales de hielo. Por lo tanto, encontrar y establecer procedimientos de mejora modificados 63, 64 para producir partículas marcadoras más uniformes tiene la máxima prioridad para optimizar el concepto de IEM de preinclusión criogénica que se presenta aquí.

      2.7 Conclusión

      Aquí describimos un protocolo de preparación de EM para cultivos de células adherentes, que permite vincular la criofijación de muestras nativas con el etiquetado de inmunogold preincrustado, como un paso hacia un mapeo 3D mejorado de la distribución de antígenos subcelulares a alta resolución. Sus principales virtudes se pueden resumir de la siguiente manera:

      (1) La detención inmediata de la morfología subcelular que cambia dinámicamente a través de medios puramente físicos (es decir, congelación rápida) evita los artefactos estructurales que acompañan a la fijación química convencional comparativamente lenta. (2) La estabilización química completa de la arquitectura celular congelada rápidamente a temperaturas muy bajas (es decir, FS a ≈ − 90 a −30 ° C) conserva la posición, las dimensiones y las proporciones de los componentes subcelulares, incluidos los subdominios de orgánulos y, a su vez, la distribución de antígenos. de una manera altamente confiable. (3) Las células correctamente marcadas resultan infiltradas uniformemente con partículas de plata de oro inmunológico en todo su volumen (Figura S2C), lo que proporciona una base sólida para las reconstrucciones 3D. (4) Excepto por la experiencia práctica en HPF y FS, no se requieren habilidades técnicas especiales aquí, ya que producir secciones de resina delgadas y semi-gruesas no es un desafío incluso para los novatos en EM y un conjunto de datos justo de perfiles celulares orientados con precisión en paralelo o ortogonalmente a los sustratos de cultivo 2D se pueden obtener fácilmente.


      Preguntas de la prueba de histología

      Un laboratorio de histología prepara portaobjetos de microscopio para examinarlos con un microscopio óptico.

      ¿Por qué es importante la histología?

      La histología es la mejor forma de comprobar el tejido. La histología es una colección de miles de técnicas que se han perfeccionado a lo largo de los años. Los médicos confían en el histólogo todos los días para obtener resultados rápidos y precisos. La medicina moderna depende cada vez más de la histología. Más del 80% de todos los diagnósticos implican algún tipo de prueba de laboratorio.

      ¿Qué es una tinción H & ampE?

      Una tinción de H & ampE demuestra el núcleo y el citoplasma de la célula, y algunos detalles tanto del núcleo como del citoplasma.

      ¿Qué es el procesamiento de parafina?

      El procesamiento de parafina convierte las muestras a un estado químico que permite cortarlas muy delgadas para colocarlas en un portaobjetos de microscopio.

      ¿Cuánto tiempo tarda una muestra promedio en pasar de la extracción a un portaobjetos terminado?

      Una muestra típica será extraída, procesada, cortada y teñida en aproximadamente dos días. Las muestras atípicas, como las de calcomanías o las muestras de neuronas muy grandes, pueden tardar más de una semana.

      ¿Qué procedimientos recomienda para obtener los mejores resultados?

      Recomendamos que la muestra se sumerja en una gran cantidad de formalina tamponada neutra al 10% tan pronto como sea posible después de que el paciente o animal fallezca o sea sacrificado. Si está realizando estudios en el cerebro u otro tejido nervioso, se debe minimizar el tiempo entre la muerte y la inmersión en formalina tamponada neutra al 10%. Se recomiendan de 5 a 10 minutos para las muestras de cerebro y médula espinal. acceder al cerebro es una tarea difícil para los técnicos sin experiencia, muchas veces se alojan fragmentos de hueso en el cerebro durante el procedimiento. Estos fragmentos producirán malos resultados durante el corte de los portaobjetos porque el hueso está compuesto principalmente de calcio. Recomendamos enjuagar bien el cerebro con formalina tamponada neutra al 10% para eliminar el polvo o los fragmentos de hueso antes de que se adentren más profundamente en el tejido. En el caso de un cerebro de ratón, debería utilizar aproximadamente 50 ml de formalina tamponada neutra al 10% por cerebro. A medida que el tejido es & # 8220 fijo & # 8221 por el formaldehído en la formalina tamponada neutra al 10%, el pH de la solución cambia. Si este PH cambia demasiado, tendrá una mala fijación y posiblemente pigmentos y artefactos en su muestra. La regla general es usar 15 veces la cantidad de líquido que el tamaño de su muestra. Si tiene una muestra de 3 cm por 3 cm, querrá utilizar 45 ml de formalina tamponada neutra al 10%. Si tiene una muestra de 20 cm por 20 cm, querrá utilizar 300 ml de formalina tamponada neutra al 10%. El uso de cualquier solución de formaldehído que no sea formalina tamponada neutra al 10% casi siempre dará malos resultados. La formalina tamponada neutra al 10% es el estándar para uso en hospitales y clínicas veterinarias. El tampón en la solución ayuda a que su tejido se fije correctamente sin tener que controlar el PH, siempre que siga la relación 1 & # 21515 de tejido a líquido. Algunos procedimientos de tinción no funcionan con formalina tamponada neutra al 10%, pero la ración 1 & # 21515 aún se aplica si está utilizando otros tipos de fijadores. El alcohol se usa a menudo como fijador para tinción fluorescente en muestras congeladas, generalmente alcohol metílico.

      Si está enviando órganos con propiedades similares a cápsulas, como riñón o hígado, corazón y pulmón, y especialmente tracto gastrointestinal & # 8230 ... Siempre querrá cortar esta cápsula para permitir que el formalina tamponada neutra al 10% tenga acceso al interior. parte del órgano. Recomendamos hacer unos pequeños cortes con la punta de un bisturí, uno a cada lado del órgano. Para los pulmones recomendamos encarecidamente inflar los pulmones por completo con formalina tamponada neutra al 10%, use una jeringa para este procedimiento y será muy fácil. Si corta el pulmón en 5 a 10 muestras, esto también tendrá excelentes resultados. El interior del pulmón tiene muchos pequeños detalles que desaparecerán después de unas horas si el pulmón no se arregla adecuadamente. Las muestras gastrointestinales mostrarán resultados sorprendentes si el interior de los órganos se fija correctamente. También se puede utilizar una jeringa para este procedimiento. Si está enviando muestras de un animal o una persona y el estómago o el tracto gastrointestinal parece estar lleno de comida, en particular comida áspera como comida para ratones, granos, vegetación, cualquier cosa con fibras o cualquier comida en general & # 8230. Limpiar el interior de estos órganos dará mejores resultados. A menos que esté estudiando alimentos para estos órganos, los alimentos no serán necesarios y, a menudo, producirán resultados deficientes en muestras que de otro modo se manipularán correctamente.

      Si está enviando hueso, un error común es colocar el hueso inmediatamente en una solución descalcificante. El hueso debe repararse al igual que otros tipos de tejido. Si no se fija, no corta en absoluto, terminas con un polvo en lugar de una sección transversal. Muchos problemas con las muestras de hueso se deben a que la muestra no se repara antes de que comience la descalcificación. El proceso de descalcificación extrae calcio a través del tejido y hacia el líquido de la calcomanía. A medida que el calcio se mueve a través del hueso, causa un daño importante a los otros componentes óseos si no se fijan. Otro error común al descalcificar el hueso es usar solo un lavado de solución. Una ración 1 & # 21515 de tejido a líquido es la proporción correcta para el procedimiento de descalcificación, pero el líquido debe cambiarse varias veces para eliminar todo el calcio. Se puede realizar una prueba química simple en el líquido de descalcificatina para decidir el punto final exacto del procedimiento. Alternativamente, si eres bueno en química, puedes calcular cuánto ácido se necesitará para disolver el calcio en masa en tu muestra.

      Recomendamos y utilizamos el siguiente procedimiento para la descalcificación.

      Soluciones necesarias:

      Use partes iguales de la solución de hidróxido de amonio al 5% y la solución de oxalato de amonio al 5% para hacer la solución de trabajo.

      Agregue 5 ml del líquido de calcomanías en el que se encuentra su muestra a 10 ml de la solución de trabajo.

      Observe la formación de precipitados. Si ve un precipitado (será fácil ver una nubosidad) cambie el líquido de descalcificación y espere uno o dos días y luego intente la prueba química nuevamente.

      Después de realizar el procedimiento varias veces con diferentes muestras, podrá comenzar a realizar estimaciones fundamentadas de los tiempos de calcomanía necesarios en función del tamaño y la masa de la muestra.

      Estos son los pasos de preparación de la muestra de histología en orden cronológico.

      Desglose de los detalles de cada paso de la histología de la lista anterior:

      Recibir una muestra de histología es el primer paso. Un asistente de histólogo o patólogo sacará la muestra de su contenedor de envío / transporte. El recipiente puede ser una caja, una bolsa o una nevera. Si la muestra está congelada, debe colocarse en un congelador de -20 o -80 lo antes posible. Cualquier información escrita que se incluya con la muestra debe revisarse para asegurarse de que la muestra y la información sean correctas y coincidan.

      Adquirir una muestra es el segundo paso. Un asistente de histólogo o patólogo comprobará la muestra real y anotará las dimensiones, la forma, el color y cualquier detalle que pueda tener la muestra. Este paso se repite durante el paso de extracción para anotar cualquier corte realizado por el asistente de histólogo o patólogo y para anotar lo que se envía para procesamiento o congelación.

      El tallado es el paso que hace que la muestra se corte en forma macroscópica para histología. Los casetes vienen en diferentes tamaños, por lo que también se elige el tamaño de casete correcto durante este paso. Un casete de tamaño común es mejor si es posible, pero algunas veces no será lo suficientemente grande para muestras como globos oculares o huevos de tortuga. ¡Muestras que no solo deben cortarse para que quepan en un casete! Para las muestras que tendrán un margen quirúrgico para verificar, estos márgenes a menudo se dividen en diferentes casetes. El cirujano a menudo marcará los lados de la muestra y cada lado marcado puede ser examinado por un patólogo.

      El procesamiento de la muestra generalmente se realiza de tres maneras:

      Para cada uno de estos pasos, los procedimientos se cuentan por miles. Se discutirá un procedimiento estándar para muestras de tamaño normal para cada uno. Tenga en cuenta que cuanto más grande sea la muestra, más largo será cada paso del procedimiento. Si la muestra es pequeña, cada paso será más corto. Espere que los pasos aumenten como se discutió para la fijación. Desea una proporción de tejido a solución fijadora de 1 a 15, del mismo modo desea esta ración para procesar muestras. Si sobrecarga las máquinas, o los contenedores si los procesa a mano, el tejido tendrá resultados horribles y tomará más tiempo y cuidado en los siguientes pasos. Esto ralentiza el flujo de trabajo en el laboratorio y todos sus amigos de histología y patología no estarán contentos con usted si lo hace. Si los bloques no se procesan correctamente y luego deben cortarse uno o dos años más tarde, es posible que no tenga detalles de las membranas o los núcleos, ¡y es posible que tampoco se manchen con IHC!

      El procesamiento de parafina es el procedimiento histológico más universal. En todos los laboratorios, este procedimiento es probablemente el único que todos los laboratorios realizan de manera casi idéntica. Si lo aprende una vez, no tendrá ningún problema al pasar de un laboratorio a otro, siempre puede tener experiencia en esta parte de la histología. Si es estudiante de histología o de patología, esto es algo que debe aprender para evitar dificultades al ejecutar su procesador. Los diferentes fabricantes diseñan los procesadores de manera diferente, y el panel de control siempre intentará ser más llamativo y fácil de usar a medida que se vendan nuevos modelos, ninguna de estas máquinas le dará mejores resultados. El procesamiento manual es la mejor y suprema manera de procesar, aunque el equipo es más extravagante que un simple procesador. El procesamiento manual es peligroso y debe abordarse como un verdadero peligro para la seguridad. Un experto no tendrá problemas, pero se debe capacitar y vigilar a un histólogo nuevo antes de realizar el procesamiento manual solo. Casi el 100 por ciento de todos los laboratorios no procesan manualmente. Es anticuado y requiere una gran cantidad de horas de técnico. Solo un laboratorio con un excelente flujo de trabajo puede procesar manualmente. Por esta razón, y por el hecho de que muchos laboratorios de histología carecen constantemente de personal en entornos hospitalarios, los procesadores automatizados son la preferencia de histólogos y patólogos en todas partes.

      Los procesadores son máquinas que tienen que procesar el tejido y luego limpiarse. Los reactivos de estas máquinas suelen ser & # 8212 formalina, alcohol, xileno y parafina. Algunos laboratorios utilizan sustituciones para estos pasos, por varias razones, como seguridad, eliminación de desechos, costo, tiempo, especificaciones del fabricante del procesador, tipos de tejidos, preferencias de temperatura de fusión, necesidades de descalcificación, necesidades específicas de especies y muchas otras razones. Los pasos básicos de formalina, alcohol, xileno y parafina se relacionan con las necesidades básicas de procesamiento. Estas necesidades son las siguientes & # 8211 Fijación, deshidratación, infiltración. La fijación conserva el tejido. La deshidratación elimina toda el agua del tejido. La infiltración es la parte más complicada del procesamiento y, en el caso de la parafina, generalmente se realiza con xileno seguido de parafina. El xileno se puede mezclar tanto con el alcohol como con la parafina y por eso se eligió. No tiene otro propósito. Los sustitutos del xileno existen desde hace muchos años y todavía muchos laboratorios prefieren el xileno. El xileno es inflamable y es una neurotoxina, esto no se muestra como un peligro en la forma en que los histólogos lo usan. En los últimos años, la seguridad ha sido un enfoque en la mayoría de los laboratorios y se han implementado nuevos protocolos para garantizar un entorno de trabajo seguro.

      Después del procesamiento, la incrustación es el siguiente paso en histología. La incrustación es un paso importante y urgente. La incrustación en parafina implica el uso de máquinas de incrustación y placas frías. Las embebidoras son dosificadores de parafina con dos grandes recipientes calientes para muestras y moldes. Las placas frías, a veces unidas a las estaciones de empotramiento, son placas de acero con un sistema de bomba de congelación. Las placas frías enfrían la parafina rápidamente para acelerar todo el proceso de inclusión.

      Cuando esté incrustando o dirigiendo a otra persona para que incruste, recuerde que el molde debe estar tibio, no frío, para un buen corte. Desea desbordar el molde, mantener el casete caliente y colocar el casete en el molde antes de que la parafina rebosante salga del molde, esto asegurará que el casete mantenga bien la parafina en su lugar y no tendrá burbujas de aire. Las burbujas de aire arruinan los bloques y pueden provocar que los niveles futuros cortados del bloque no coincidan con los niveles iniciales debido a la necesidad de volver a incrustar la muestra debido a una burbuja de aire. Se formarán pequeñas burbujas de aire en cualquier tejido que tenga una cavidad, como un corazón. Estas cavidades se pueden rellenar la mayor parte del tiempo, y el cuidado de hacerlo garantizará cortes adecuados.

      Otro punto de la incrustación es eliminar el exceso de cera de los bloques. La mayoría de los laboratorios ahora usan un fundidor de bloques caliente que está inclinado para permitir que la parafina gotee hacia un recipiente. El histólogo nuevo se derretirá en bloques a la vez, y tenga cuidado de no tocar la placa caliente con el área de corte del bloque. Los histólogos más experimentados pueden fundir varios a la vez para ahorrar tiempo. Esta técnica no afecta el corte, pero los tamaños de bloque más grandes no se fundirán al 100% en la cara del bloque en ángulo donde se escriben los datos de identificación del bloque. Por esta razón, la superficie de escritura a menudo se limpia nuevamente mientras se corta por técnicos más experimentados.

      A partir de este punto de la guía de estudio, se utilizará la jerga de histología. Si no sabe qué significa un término en este momento, se incluirá un glosario al final de la guía.

      Cuadra& # 8211 una muestra incrustada lista para ser cortada, a menudo tiene 2 partes, un casete que se adjunta a la misma para colocarla en un microtomo y con fines de etiquetado. Para congelados, esto también puede significar un trozo de tejido congelado incrustado.

      Bruto& # 8211 el espécimen que se examina y registra

      Histología& # 8211 el estudio del tejido.

      Histotecnología& # 8211 la ciencia de laboratorio de preparar tejido para examen microscópico.

      H & ampE- una tinción que muestra detalles de la célula, núcleos contrastantes del citoplasma. Esta es, con mucho, la tinción más común del mundo para tejidos. H & ampE son las siglas de & # 8220Hematoxilina y eosina & # 8221. Por lo general, esta tinción sigue protocolos similares, siendo la variación más notable la adición de floxina a la eosina. La floxina tiñe de un rojo intenso algunos componentes del tejido y algunos médicos la prefieren. La hematoxilina es un reactivo que se prepara con mucho cuidado y necesita tiempo para madurar durante la última fase de preparación. El proceso se ha comparado con la elaboración de vino, aunque de hecho es una tarea que requiere mucho menos tiempo y no se puede beber. La hematoxilina y la eosina se filtran siempre y antes del primer uso.


      Ver el vídeo: What is SNAP FREEZING? What does SNAP FREEZING mean? SNAP FREEZING meaning u0026 explanation (Febrero 2023).