Información

¿Las proteínas contienen fósforo? Si es cierto, ¿cómo Alfred Hershey y Martha Chase utilizaron la afirmación de que las proteínas no contienen fósforo?

¿Las proteínas contienen fósforo? Si es cierto, ¿cómo Alfred Hershey y Martha Chase utilizaron la afirmación de que las proteínas no contienen fósforo?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Escuché que el fósforo es un constituyente de ciertas proteínas, aunque sabemos que ningún aminoácido tiene fósforo ... y si es cierto, entonces cómo Alfred Hershey y Martha Chase fueron aclamados, cuya base del experimento fue que "la proteína no tienes fósforo "??


Sí, algunas de las proteínas contienen fósforo, pero en el experimento (experimento de Hershey y Chase) usaron bacteriófagos, su vaina proteica contiene carbono, hidrógeno, nitrógeno y azufre, mientras que el ADN del bacteriófago contiene carbono, hidrógeno, nitrógeno y fósforo (en el ácido). por lo que seleccionaron esto para ese experimento, además, el azufre está ausente en el ADN, pero el fósforo no, por lo que se puede concluir que el ADN es lo que se transfirió Referencia: NCERT


Sí, ninguno de los aminoácidos contiene fósforo en su cadena lateral, pero se introduce durante la modificación postraduccional. Esto ayuda a la estabilidad y al buen funcionamiento de las proteínas. (A través de: https: //www.ncbi.nlm.nih.gov/pmc/articles/PMC3415839/.

Como el fósforo es el componente principal de los ácidos nucleicos, no de las proteínas, su uso en la producción de nuevos bacteriófagos representará la utilización de fósforo en la síntesis de ácidos nucleicos. Además, utilizando el experimento de la licuadora, Hershey y Chase separaron la cubierta proteica del bacteriófago de sus núcleos. Y luego introdujo este ácido nucleico en la bacteria y descubrió que puede reproducirse para sintetizar nuevos virus. Y esto demostró que el ácido nucleico es responsable de la transmisión de información genética.
(Vía: https://embryo.asu.edu/pages/hershey-chase-experiments-1952-alfred-hershey-and-martha-chase)


Es cierto que ningún aminoácido contiene fósforo, pero debido a modificaciones postraduccionales algunas proteínas pueden fosforilarse. Además, existen proteínas enzimáticas como la glucógeno fosforilasa b, que son proteínas relativamente inactivas, y el cambio a las formas activas (glucógeno fosforilasa a) puede llevarse a cabo por la acción de la fosforilasa quinasa (Lehninger. Principles of Biochemistry. 5th Ed. .)


Samacheer Kalvi 12th Bio Zoology Molecular Genetics Text Book Volver Preguntas y respuestas

Pregunta 1.
El experimento de Hershey y Chase con bacteriófagos mostró que
(a) La proteína ingresa a las células bacterianas
(b) el ADN es el material genético
(c) el ADN contiene azufre radiactivo
(d) Los virus se transforman
Respuesta:
(b) el ADN es el material genético

Pregunta 2.
El ADN y el ARN son similares con respecto a
(a) Timina como base de nitrógeno
(b) Una forma de hélice monocatenaria
(c) Nucleótidos que contienen azúcares, bases nitrogenadas y fosfatos.
(d) La misma secuencia de nucleótidos para el aminoácido fenilalanina.
Respuesta:
(c) Nucleótidos que contienen azúcares, bases nitrogenadas y fosfatos.

Pregunta 3.
Una molécula de ARNm es producida por
(a) Replicación
(b) Transcripción
(c) Duplicación
(d) Traducción
Respuesta:
(b) Transcripción

Pregunta 4.
Se estima que el número total de bases nitrogenadas en el genoma humano es de aproximadamente
(a) 3,5 millones
(b) 35000
(c) 35 millones
(d) 3,1 mil millones
Respuesta:
(d) 3,1 mil millones

Pregunta 5.
Las células de E. coli cultivadas en medio 15N se transfieren a medio 14N y se dejan crecer durante dos generaciones. El ADN extraído de estas células se ultracentrifuga en un gradiente de densidad de cloruro de cesio. ¿Qué distribución de densidad de ADN esperarías en este experimento?
(a) Una banda de alta y una de baja densidad
(b) Una banda de densidad intermedia
(c) Una banda de densidad alta y otra intermedia
(d) Una banda de densidad baja y otra intermedia
Respuesta:
(d) Una banda de densidad baja y otra intermedia

Pregunta 6.
¿Cuál es la base de la diferencia en la síntesis de la cadena principal y rezagada de moléculas de ADN?
(a) El origen de la replicación ocurre solo en el extremo 5 'de las moléculas
(b) La ADN ligasa funciona solo en la dirección 3 '→ 5'
(c) La ADN polimerasa puede unir nuevos nucleótidos solo al extremo 3 'del rodal en crecimiento.
(d) Helicasas y proteínas de unión de una sola hebra que funcionan en el extremo 5 '
Respuesta:
(d) Helicasas y proteínas de unión de una sola hebra que funcionan en el extremo 5 '

Pregunta 7.
¿Cuál de las siguientes es la secuencia correcta de eventos con referencia al dogma central?
(a) Transcripción, traducción, replicación
(b) Transcripción, replicación, traducción
(c) Duplicación, traducción, transcripción
(d) Replicación, transcripción, traducción
Respuesta:
(d) Replicación, transcripción, traducción

Pregunta 8.
¿Cuál de las siguientes afirmaciones sobre la replicación del ADN no es correcta?
(a) El desenrollamiento de la molécula de ADN ocurre cuando se rompen los enlaces de hidrógeno.
(b) La replicación ocurre cuando cada base se empareja con otra exactamente igual
(c) El proceso se conoce como replicación semi & # 8211 conservadora porque una hebra antigua se conserva en la nueva molécula
(d) Los pares de bases complementarios se mantienen unidos con enlaces de hidrógeno.
Respuesta:
(b) La replicación ocurre cuando cada base se empareja con otra exactamente igual

Pregunta 9.
¿Cuál de las siguientes afirmaciones no es cierta sobre la replicación del ADN en eucariotas?
(a)) La replicación comienza en un solo origen de replicación.
(b) La replicación es bidireccional desde los orígenes.
(c) La replicación se produce a aproximadamente 1 millón de pares de bases por minuto.
(d) Existen numerosos cromosomas bacterianos diferentes, y la replicación ocurre en cada uno al mismo tiempo.
Respuesta:
(d) Existen numerosos cromosomas bacterianos diferentes, y la replicación ocurre en cada uno al mismo tiempo.

Pregunta 10.
El primer codón que se descifró fue qué códigos para
(a) AAA, prolina
(b) GGG, alanina
(c) UUU, fenilalanina
(d) TTT, arginina
Respuesta:
(c) UUU, fenilalanina

Pregunta 11.
El experimento de Meselson y Stahl demostró __________
(a) Transducción
(b) Transformación
(c) el ADN es el material genético
(d) Naturaleza semiconservadora de la replicación del ADN
Respuesta:
(d) Naturaleza semiconservadora de la replicación del ADN

Pregunta 12.
Los ribosomas se componen de dos subunidades, la subunidad más pequeña de un ribosoma tiene un sitio de unión y la subunidad más grande tiene dos sitios de unión para dos
Respuesta:
ARNm, ARNt

Pregunta 13.
Anoperonisa:
(a) Proteína que suprime la expresión génica
(b) Proteína que acelera la expresión génica
(c) Grupo de genes estructurales con función relacionada
(d) Gen que activó o desactivó otros genes
Respuesta:
(d) Gen que activó o desactivó otros genes

Pregunta 14.
Cuando la lactosa está presente en el medio de cultivo:
(a) Se produce la transcripción de los genes lacy, lac z, lac a
(b) El represor no puede unirse al operador
(c) El represor puede unirse al operador
(d) Ambos (a) y (b) son correctos
Respuesta:
(d) Ambos (a) y (b) son correctos

Pregunta 15.
Da razones: el código genético es "universal".
Respuesta:
El código genético es universal. Significa que todos los sistemas vivos conocidos usan ácidos nucleicos y los mismos codones de tres bases (codón triplete) dirigen la síntesis de proteínas a partir de aminoácidos. Por ejemplo, el codón del ARNm (UUU) codifica la fenilalanina en todas las células de todos los organismos. Se informan algunas excepciones en genomas procarióticos, mitocondriales y de cloroplasto. Sin embargo, las similitudes son más comunes que las diferencias.

Pregunta 16.
Nombra las partes marcadas con "A" y "B" en la unidad de transcripción dada:
Respuesta:

Pregunta 17.
Diferenciar & # 8211 Hebra principal y hebra rezagada
Respuesta:

  1. ADN polimerasa I Mecanismo de reparación del ADN involucrado
  2. ADN polimerasa II Mecanismo de reparación del ADN involucrado
  3. ADN polimerasa III involucrada en la replicación del ADN

Pregunta 18.
Diferenciar & # 8211 hebra de plantilla y hebra de codificación.
Respuesta:

  1. Cadena de plantilla: durante la replicación, la cadena de ADN que tiene la polaridad 3 '→ 5' actúa como cadena de plantilla.
  2. Cadena de codificación: durante la replicación, la cadena de ADN que tiene la polaridad 5 '→ 3' actúa como cadena de codificación.

Pregunta 19.
Mencione dos formas en las que el polimorfismo de un solo nucleótido (SNP) identificado en el genoma humano puede traer un cambio revolucionario en la ciencia biológica y médica.
Respuesta:
Los científicos han identificado alrededor de 1,4 millones de ubicaciones, donde las diferencias de ADN de una sola base (SNP & # 8211 Polimorfismo de nucleótido único & # 8211 pronunciado como "snips") ocurren en humanos. La identificación de "SNIPS" es útil para encontrar ubicaciones cromosómicas para secuencias asociadas a enfermedades y rastrear la historia humana.

Pregunta 20.
Enuncie tres objetivos del proyecto del genoma humano.
Respuesta:

  1. Identifique todos los genes (aproximadamente 30000) en el ADN humano.
  2. Determine la secuencia de los tres mil millones de pares de bases químicas que componen el ADN humano.
  3. Almacenar esta información en bases de datos.

Pregunta 21.
En E. coli, se producen tres enzimas O-galactosidasa, permeasa y transacetilasa en presencia de lactosa. Explique por qué las enzimas no se sintetizan en ausencia de lactosa.
Respuesta:
En ausencia de lactosa, la proteína represora se une al operador e impide la transcripción del gen estructural por la ARN polimerasa, por lo que no se producen las enzimas. Sin embargo, siempre habrá un nivel mínimo de expresión del operón lac incluso en ausencia de lactosa.

Pregunta 22.
Distinguir entre gen estructural, gen regulador y gen operador.
Respuesta:
Estructura del operón: cada operón es una unidad de expresión y regulación génica y consta de uno o más genes estructurales y un gen operador adyacente que controla la actividad transcripcional del gen estructural.

  1. El gen estructural codifica proteínas, rRNA y tRNA requeridos por la célula.
  2. Los promotores son las secuencias señal en el ADN que inician la síntesis de ARN. La ARN polimerasa se une al promotor antes del inicio de la transcripción.
  3. Los operadores están presentes entre los promotores y los genes estructurales. La proteína represora se une a la región operadora del operón.

Pregunta 23.
Un bajo nivel de expresión del operón lac ocurre todo el tiempo en E-coli. Justifica la afirmación.
Respuesta:
Una de las enzimas sintetizadas por el operón lac es la permeasa, que participa en el transporte de lactosa al interior de las células. Si el operón lac se inactiva, la permeasa no se sintetiza, por lo que la lactosa no puede ingresar a la célula. La lactosa actúa como inductor, se une a la proteína represora y activa al operador para iniciar la expresión génica.

Pregunta 24.
¿Por qué el proyecto del genoma humano se llama megaproyecto?
Respuesta:
El proyecto internacional del genoma humano se lanzó en el año 1990. Fue un megaproyecto y tardó 13 años en completarse. El genoma humano es aproximadamente 25 veces más grande que el genoma de cualquier organismo secuenciado hasta la fecha y es el primer genoma de vertebrado en completarse. Se dice que el genoma humano tiene aproximadamente 3 & gt109 pb. HGP estuvo estrechamente asociado con el rápido desarrollo de una nueva área en biología llamada bioinformática.

Pregunta 25.
A partir de su examen de la estructura del ADN, ¿qué dedujeron Watson y Crick sobre el probable mecanismo de replicación, capacidad de codificación y mutación del ADN?
Respuesta:
Inferencia de Watson y Crick sobre la replicación del ADN: Llegaron a la conclusión de que cada una de las cadenas de ADN en una hélice actúa como plantilla durante la replicación del ADN, lo que lleva a la formación de nuevas moléculas de ADN hijas, que son complementarias a la cadena parental (es decir, método semiconservador de replicación) Inferencia sobre la capacidad de codificación: Durante la transcripción, la información genética en la hebra de ADN se codifica en ARNm como bases complementarias (excepto para uracilo en lugar de timina en el ARN) Inferencia sobre mutación: Cualquier cambio en la secuencia de nucleótidos del ADN conduce a alteración correspondiente en la secuencia de aminoácidos de una proteína específica, lo que confirma la validez del código genético.

Pregunta 26.
¿Por qué el ARNt se llama molécula adaptadora?
Respuesta:
La molécula de ARN de transferencia (ARNt) de una célula actúa como un vehículo que recoge los aminoácidos esparcidos por el citoplasma y también lee códigos específicos de moléculas de ARNm. Por eso se le llama molécula adaptadora. Este término fue postulado por Francis Crick.

Pregunta 27.
¿Cuáles son las tres diferencias estructurales entre el ARN y el ADN?
Respuesta:
ADN:

  1. El azúcar es azúcar desoxirribosa.
  2. Estructura bicatenaria.
  3. Las bases nitrogenadas son adenina, guanina, citosina y timina.
  1. El azúcar es azúcar ribosa.
  2. Molécula monocatenaria.
  3. Las bases nitrogenadas son adenina, guanina, citosina y uracilo.

Pregunta 28.
Nombre el anticodón necesario para reconocer los siguientes codones:
AAU, CGA, UAU y GCA.
Respuesta:
UUA, GCU, AUA y CGU.

Pregunta 29.
(a) Identifique la figura que se da a continuación
(b) Vuelva a dibujar la estructura como una bifurcación de replicación y etiquete las partes
(c) Escriba la fuente de energía para esta replicación y nombre la enzima involucrada en este proceso.
(d) Mencione las diferencias en la síntesis de proteínas, basadas en la polaridad de las dos cadenas molde.
Respuesta:
(a) Bifurcación de replicación
(B)

(c) Deoxi nucleótido, el trifosfato actúa como fuente de energía para la replicación. La ADN polimerasa se utiliza para la replicación.
(d) La información de contacto del ARNm para la síntesis de proteínas se desarrollará a partir de una cadena de ADN con polaridad 5 '→ 3'

Pregunta 30.
Si la secuencia de codificación en una unidad de transcripción se escribe de la siguiente manera:
5 ’TGCATGCATGCATGCATGCATGCATGC 3’
Anote la secuencia de ARNm.
Respuesta:
La secuencia de ARNm es 3’ACGUACGUACGUUCGUACGUACGUACG5 ’

Pregunta 31.
¿Qué ventajas tiene el proceso de síntesis de proteínas en dos etapas?
Respuesta:
La característica del gen dividido de los genes eucariotas está casi completamente ausente en los procariotas. Originalmente, cada exón puede haber codificado una única cadena polipeptídica con una función específica. Dado que la disposición de los exones y la eliminación de los intrones son flexibles, el exón que codifica estas subunidades polipeptídicas actúa como dominios que se combinan de diversas formas para formar nuevos genes. Los genes individuales pueden producir diferentes proteínas funcionales ordenando sus exones de varias formas diferentes a través de patrones de empalme alternativos, un mecanismo conocido por desempeñar un papel importante en la generación de diversidad funcional y de proteínas en los animales. Los intrones habrían surgido antes o después de la evolución del gen eucariota.

Si los intrones surgieron tarde, ¿cómo entraron en el gen eucariota? Los intrones son secuencias de ADN móviles que pueden empalmarse de, así como en, "sitios objetivo" específicos que actúan como elementos móviles similares a transposones (que median la transferencia de genes entre organismos & # 8211 Horizontal Gene Transfer & # 8211 HGT). La HGT ocurre entre linajes de células procariotas, o de células procariotas a eucariotas y entre células eucariotas. Ahora se plantea la hipótesis de que la HGT jugó un papel importante en la evolución de la vida en la Tierra.

Pregunta 32.
¿Por qué Hershey y Chase utilizaron únicamente fósforo y azufre marcados radiactivamente? ¿Habrían obtenido el mismo resultado si usaran carbono y nitrógeno radiomarcados?
Respuesta:
Generalmente las proteínas contienen azufre pero no fósforo y el ácido nucleico (ADN) contiene fósforo pero no azufre. Por lo tanto, Hershey & # 8211 Chase utilizó isótopos radiactivos de azufre (3 5 S) y fósforo (32 P) para realizar un seguimiento separado de la proteína viral y el ácido nucleico en el medio de cultivo. No se puede lograr el resultado esperado si se usa carbono y nitrógeno radiactivos, ya que estas moléculas están presentes tanto en el ADN como en las proteínas.

Pregunta 33.
Explica la formación de un nucleosoma.
Respuesta:
Komberg propuso un modelo para el nucleosoma, en el que 2 moléculas de las cuatro proteínas histonas H2A, H2B, H3 y H4 se organizan para formar una unidad de ocho moléculas llamada histona octamere.

El ADN cargado negativamente se envuelve alrededor del octamero de histonas cargadas positivamente para formar una estructura llamada nucleosoma. Un nucleosoma típico contiene 200 pb de hélice de ADN. Los octameros de histonas están en estrecho contacto y el ADN está enrollado en el exterior del nucleosoma.

Pregunta 34.
Está establecido que el ARN es el primer material genético. Justifica dando razones.
Respuesta:
Tres biólogos moleculares a principios de la década de 1980 (Leslie Orgel, Francis Brick y Carl Woese) propusieron de forma independiente el "mundo del ARN" como la primera etapa en la evolución de la vida, una etapa en la que el ARN catalizaba todas las moléculas necesarias para la supervivencia y la replicación. El término "mundo de ARN", utilizado por primera vez por Walter Gilbert en 1986, plantea la hipótesis de que el ARN es la primera genética de la Tierra. Ahora hay suficiente evidencia para sugerir que los procesos vitales esenciales (como el metabolismo, la traducción y el empalme, etc.) evolucionaron alrededor del ARN. El ARN tiene la capacidad de actuar como material genético y catalizador. Hay varias reacciones bioquímicas en los sistemas vivos que son catalizadas por ARN. Este ARN catalítico se conoce como ribozima. Pero, el ARN como catalizador era reactivo y, por lo tanto, inestable.

Esto condujo a la evolución de una forma de ADN más estable, con ciertas modificaciones químicas. Dado que el ADN es una molécula de doble hebra que tiene una hebra complementaria, ha resistido los cambios al desarrollar un proceso de reparación. Algunas moléculas de ARN funcionan como reguladores de genes al unirse al ADN y afectar la expresión de genes. Algunos virus usan ARN como material genético. Andrew Fire y Craig Mellow (ganadores del Premio Nobel en 2006) opinaron que el ARN es un ingrediente activo en la química de la vida.

Samacheer Kalvi 12th Bio Zoology Molecular Genetics Preguntas y respuestas adicionales

Pregunta 1.
El término "gen" fue acuñado por ___________
Respuesta:
Wilhelm Johannsen

Pregunta 2.
¿El experimento de quién finalmente proporcionó evidencia convincente de que el ADN es el material genético?
(a) Experimento de Griffith
(b) El experimento de Avery, Macleod y McCarty
(c) Experimento de Hershey-Chase
(d) Experimento de Urey-Miller
Respuesta:
(c) Experimento de Hershey-Chase

Pregunta 3.
En el experimento de Hershey & # 8211 Chase, el ADN de la fase T 2 se hizo radioactivo usando ___________
(a) 32 P
(b) 32 S
(c) 35 P
(d) 32 S
Respuesta:
(a) 32 P

Pregunta 4.
Un nucleósido se compone de ___________
(a) Azúcar y fosfato
(b) Base de nitrógeno y fosfato
(c) Base de azúcar y nitrógeno
(d) Azúcar, fosfato y base nitrogenada
Respuesta:
(c) Base de azúcar y nitrógeno

Pregunta 5.
Identificar la declaración incorrecta
(a) una base es una sustancia que acepta iones H +
(b) Tanto el ADN como el ARN tienen cuatro bases
(c) Las purinas tienen un solo anillo carbono-nitrógeno
(d) La timina es única para el ADN
Respuesta:
(c) Las purinas tienen un solo anillo carbono-nitrógeno

Pregunta 6.
Watson y Crick propusieron su modelo de ADN de doble hélice basado en el análisis de difracción de rayos X de ___________
a) Erwin Chargaff
(b) Meselson y Stahl
(c) Wilkins y Franklin
(d) Griffith
Respuesta:
(c) Wilkins y Franklin

Pregunta 7.
El término "mundo de ARN" fue utilizado por primera vez por ___________
Respuesta:
Walter Gilbert

Pregunta 8.
La distancia entre dos pares de bases consecutivos en el ADN es ___________
(a) 0,34 nm
(b) 3,4 nm
(c) 0,034 nm
(d) 34 millas náuticas
Respuesta:
(a) 0,34 nm

Pregunta 9.
Si la longitud del ADN de E. coli es 1,36 mm, el número de pares de bases es ___________
(a) 0,36 × 10 6 m
(b) 4 × 10 6 m
(c) 0,34 × 10 -9 nm
(d) 4 × 10 -9 m
Respuesta:
(b) 4 × 10 6 m

Pregunta 10.
Identificar la secuencia adecuada en la organización del cromosoma eucariota.
(a) Nucleosoma & # 8211 Solenoide & # 8211 Cromátida
(b) Cromátida y nucleosoma # 8211 y solenoide # 8211
(c) Solenoide y cromatina # 8211 y ADN # 8211
(d) Nucleosoma & # 8211 solenoide & # 8211 genophore
Respuesta:
(a) Nucleosoma & # 8211 Solenoide & # 8211 Cromatid

Pregunta 11.
Afirmación (A): el genóforo se nota en los procariotas.
Razón (R): Las bacterias poseen ADN circular sin organización de cromatina.
(a) Tanto A como R son correctos
(b) A es correcto R es incorrecto
(c) R explica A
(d) A es incorrecto R es correcto
Respuesta:
(c) R explica A

Pregunta 12.
Afirmación (A): La heterocromatina es transcripcionalmente activa.
Razón (R): cromatina compacta que se tiñe de oscuro.
(a) Tanto A como R son correctos
(b) A es correcto R es incorrecto
(c) R explica A
(d) A es incorrecto R es correcto
Respuesta:
(d) A es incorrecto R es correcto

Pregunta 13.
Afirmación (A): Hershey y Chase propusieron un modelo semiconservador.
Razón (R): El ADN hijo contiene solo hebras nuevas.
(a) Tanto A como R son incorrectos
(b) A es correcto R es incorrecto
(c) R explica A
(d) A es incorrecto R es correcto
Respuesta:
(a) Tanto A como R son incorrectos

Pregunta 14.
La enzima de Komberg se llama _____
Respuesta:
ADN polimerasa I

Pregunta 15.
La replicación del ADN ocurre en la fase __________ del ciclo celular.
(soy
(b) S
(c) G1
(d) G2
Respuesta:
(b) S

Pregunta 16.
El modelo semiconservador de replicación fue probado por __________
(a) Hershey y Chase
(b) Griffith
(c) Meselson y Stahl
(d) Macleod y McCarty
Respuesta:
(c) Meselson y Stahl

Pregunta 17.
¿Cuántos tipos de ADN polimerasas posee una célula eucariota?
(un dos
(b) tres
(c) cuatro
(d) cinco
Respuesta:
(d) Cinco

Pregunta 18.
Identificar la declaración incorrecta
(a) La replicación ocurre en el sitio ori & # 8211 del ADN
(b) El trifosfato de desoxi nucleótido actúa como sustrato
(c) El desenrollamiento de la cadena de ADN se lleva a cabo mediante topoisomerasa.
(d) La ADN polimerasa cataliza la polimerización en 3-OH
Respuesta:
(c) El desenrollamiento de la cadena de ADN se lleva a cabo mediante topoisomerasa.

Pregunta 19.
Los fragmentos de hebra rezagada sintetizados de forma discontinua se denominan ________
Respuesta:
Fragmentos de Okazaki

Pregunta 20.
Los retrovirus poseen ________ como material genético.
Respuesta:
ARN

Pregunta 21.
¿Qué NO forma parte de la unidad de transcripción?
(a) Promotor
(b) Operador
(c) Gen estructural
(d) Terminador
Respuesta:
(b) Operador

Pregunta 22.
Goldberg & # 8211 Hogness caja de eucariotas es equivalente a ________ de procariotas.
Respuesta:
Caja Pribnow

Pregunta 23.
Los fragmentos de Okazaki son unidos por la enzima ________ durante la replicación del ADN.
Respuesta:
ADN ligasa

Pregunta 24.

Respuesta:
(a) A & # 8211 iv, B & # 8211 i, C & # 8211 ii, D & # 8211 iii

Pregunta 25.
La ARN polimerasa de los procariotas se une al factor para iniciar la polimerización.
(a) rho
(b) theta
(c) sigma
(d) psi
Respuesta:
(c) sigma

Pregunta 26.

(a) Tapado
(b) Colas
(c) Empalme
(d) Transcripción
Respuesta:
(c) Empalme

Pregunta 27.
¿Cuál de las siguientes características está ausente en los procariotas?
(a) Los procariotas poseen tres tipos principales de ARN
(b) Los genes estructurales son policistrónicos
(c) El proceso de inicio de la transcripción requiere el factor "P"
(d) Característica del gen dividido
Respuesta:
(d) Característica del gen dividido

Pregunta 28.
¿Cuál de las siguientes secuencias se ha traducido por completo?
(i) AGA, UUU, UGU, AGU, UAG
(ii) AUG, UUU, AGA, UAC, UAA
(iii) AAA, UUU, UUG, UGU, UGA
(iv) AUG, AAU, AAC, UAU, UAG
(a) iy ii
(b) ii solamente
(c) i y iii
(d) ii y iv
Respuesta:
(d) ii y iv

Pregunta 29.
El taponamiento del ARNm se produce mediante __________
(a) Residuos de poli A
(b) Trifosfato de metil guanosina
(c) Trifosfato de desoxi ribonucleótido
(d) Trifosfato de ribonucleótido
Respuesta:
(b) Trifosfato de metil guanosina

Pregunta 30.
¿Uno de los aspectos no es una característica del código genético?
(especifico
(b) Degenerado
(c) Universal
(d) ambiguo
Respuesta:
(d) ambiguo

Pregunta 31.
¿Cuál de los codones del triplete no es un código de prolina?
(i) CCU
(ii) CAU
(iii) CCG
(iv) CAA
(a) yo solo
(b) ii y iv
(c) iii solamente
(d) todo lo anterior
Respuesta:
(b) ii y iv

Pregunta 32.
Las secuencias codificantes que se encuentran en genes divididos se denominan.
(a) Operones
(b) Intrones
(c) Exones
(d) Cistron
Respuesta:
(c) Exones

Pregunta 33.
¿Cuál de los siguientes ARNm produce 6 aminoácidos después de la traducción?
(i) UCU UAU AGU CGA UGC AGU UGA AAA UUU
(ii) UGA AGA UAG GAG CAU CCC UAC UAU GAU
(iii) GUC UGC UGG GCU GAU UAA AGG AGC AUU
(iv) AGO UAC CAU UGC UGA UGC AGG AGC CCG
Respuesta:
(i) UCU UAU AGU CGA UGC AGU UGA AAA UUU

Pregunta 34.
El factor de terminación de la transcripción asociado con la ARN polimerasa en procariotas es
(a) θ
(b) σ
(c) ρ
(d) ∑
Respuesta:
(c) ρ

Pregunta 35.
En una doble hebra de ADN, si la guanina es del 30%, ¿cuál será el porcentaje de timina?
(a) 100%
(b) 20%
(c) 10%
(d) 70%
Respuesta:
(b) 20%

Pregunta 36.
Identificar los pares de tripletes que codifican la tirosina.
(a) UUU, UUC
(b) UAU, UAU
(c) UGC, UGU
(d) CAU, CAC
Respuesta:
(b) UAU, UAU

Pregunta 37.

Respuesta:
A & # 8211 ii B & # 8211 i C & # 8211 iv D & # 8211 iii

Pregunta 38.
El código AUG es para __________
(a) Arginina
(b) Tirosina
(c) Triptófano
(d) Metionina
Respuesta:
(d) Metionina

Pregunta 39.
La secuencia de bases en la cadena codificante de ADN es G A G T T A G C A G G C, entonces la secuencia de codones en la transcripción primaria es
(a) C U C A U A C G C C C G
(b) C U C A A U C G U C C G
(c) U C A G A U C U G C G C
(d) U U C A A U C G U G C G
Respuesta:
(b) C U C A A U C G U C C G

Pregunta 40.
La región promotora de eucariota es __________
(a) TATAA
(b) AGOSTO
(c) UUUGA
(d) AAAAU
Respuesta:
(a) TATAA

Pregunta 41.
Une el siguiente:
(A) AUG y # 8211 (i) Tirosina
(B) UGA y # 8211 (ii) Glicina
(C) UUU y # 8211 (iii) Metionina
(D) GGG y # 8211 (iv) Fenilalanina
(a) A & # 8211 iii B & # 8211 i C & # 8211 iv D & # 8211 ii
(b) A & # 8211 iii B & # 8211 ii C & # 8211 i D & # 8211 iv
(c) A & # 8211 iv B & # 8211 i C & # 8211 iii D & # 8211 ii
(d) A & # 8211 ii B & # 8211 i C & # 8211 iv D & # 8211 iii
Respuesta:
(d) A & # 8211 ii B & # 8211 i C & # 8211 iv D & # 8211 iii

Pregunta 42.
__________ número de codones, códigos de cistina.
Respuesta:
Dos

Pregunta 43.
En la anemia de células falciformes, se modifica el codón __________ del gen de la globina β & # 8211.
(a) Octavo
(b) Séptimo
(c) Sexta
(d) Noveno
Respuesta:
(c) Sexta

Pregunta 44.
Elija la declaración incorrecta.
(a) El ARNt actúa como una molécula adaptadora
(b) Los codones de parada no tienen ARNt
(c) La adición de aminoácidos conduce a la hidrólisis del ARNt.
(d) ARNt tiene cuatro bucles principales
Respuesta:
(c) La adición de aminoácidos conduce a la hidrólisis del ARNt.

Pregunta 45.
¿Cuál de los siguientes antibióticos inhibe la interacción entre el ARNt y el ARNm?
(a) Neomicina
(b) Estreptomicina
(c) tetraciclina
(d) Cloranfenicol
Respuesta:
(a) Neomicina

Pregunta 47.
El grupo de genes con función relacionada se llama _________
(a) Cistron
(b) Operón
(c) Mutón
(d) Reconocimiento
Respuesta:
(b) Operón

Pregunta 48.
La proteína represora del operón Lac se une a __________ del operón.
(a) Región promotora
(b) Región del operador
(c) región del terminador
(d) región inductora
Respuesta:
(b) Región del operador

Pregunta 49.
Códigos del gen Lac Z para __________
(a) Permease
(b) transacetilasa
(c) β-galactosidasa
(d) Aminoacil transferasa
Respuesta:
(c) β-galactosidasa

Pregunta 50.
El modelo del operón lac fue propuesto por __________
Respuesta:
Jacob y Monod

Pregunta 51.
El recuento aproximado de pares de bases en el genoma humano es __________
Respuesta:
3 × 10 9 pb

Pregunta 52.
Las secuencias de ADN automatizadas son desarrolladas por.
Respuesta:
Frederick Sanger

Pregunta 53.
¿Cuál de los cromosomas tiene mayor densidad genética?
(a) Cromosoma 20
(b) Cromosoma 19
(c) Cromosoma 13
(d) Cromosoma Y
Respuesta:
(b) Cromosoma 19

Pregunta 54.
La cantidad de genes ubicados en el cromosoma Y es __________
(a) 2968
(b) 213
(c) 2869
(d) 231
Respuesta:
(d) 231

Pregunta 55.
¿Cuántos genes estructurales se encuentran en el operón lac de E. Coli?
(a) 4
(b) 3
(c) 2
(d) 1
Respuesta:
(b) 3

Pregunta 56.
La técnica de impresión digital de ADN fue desarrollada por
(a) Jacob y Monod
(b) Alec Jeffreys
(c) Frederick Sanger
Respuesta:
(b) Alec Jeffreys

Pregunta 57.
En la toma de huellas dactilares de ADN, la separación de los fragmentos de ADN se realiza mediante __________
(a) Centrifugación
(b) Electroforesis
(c) difracción de rayos X
(d) desnaturalización
Respuesta:
(b) Electroforesis

Pregunta 58.
SNP significa
(a) Polimorfismo de un solo nucleótido
(b) Polipéptido de un solo nucleósido
(c) Polimorfismo de un solo nucleótido
(d) Polímero de un solo nucleótido
Respuesta:
(a) Polimorfismo de un solo nucleótido

Pregunta 59.
Las secuencias específicas de ARNm que no se traducen son __________
Respuesta:
Regiones sin traducir (UTR)

Pregunta 60.
La secuencia de ADN no codificante o interviniente se llama __________

Pregunta 61.
_______ Intron es el monómero del ADN.
Respuesta:
Nucleótido

Pregunta 62.
¿Cuál de las siguientes coincidencias no coincide?
(a) Transcripción & # 8211 Copia de información de ADN a ARN
(b) Traducción & # 8211 Decodificación de información de ARNm a proteína
(c) Replicación y # 8211 Realización de copias de ADN
(d) Empalme y # 8211 Unión de exones con intrones
Respuesta:
(d) Empalme y # 8211 Unión de exones con intrones

Pregunta 1.
¿Quién propuso la hipótesis de Un gen & # 8211 Una enzima? Defínalo.
Respuesta:
George Beadle y Edward Tatum propusieron la hipótesis de Un gen & # 8211 Una enzima que establece que un gen controla la producción de una enzima.

Pregunta 2.
Diferenciar nucleósido de nucleótido.
Respuesta:

  1. Nucleósido: la subunidad de nucleósido está compuesta de bases nitrogenadas unidas a una molécula de azúcar pentosa.
  2. Nucleótido: la subunidad de nucleótidos está compuesta por bases nitrogenadas, un azúcar pentosa y un grupo fosfato.

Pregunta 3.
Indique las diferencias clave entre el ADN y el ARN.
Respuesta:
ADN:

  1. El ADN está hecho de azúcar desoxirribosa.
  2. Las bases nitrogenadas del ADN son adenina, guanina, citosina y timina.
  1. El ARN está hecho de azúcar ribosa.
  2. Las bases nitrogenadas del ARN son adenina, guanina, citosina y uracilo.

Pregunta 4.
Señale las bases nitrogenadas del ARN.
Respuesta:
Adenina, Guanina, Citosina y Uracilo.

Pregunta 5.
¿Qué hace que el ADN y el ARN sean moléculas ácidas?
Respuesta:
El grupo funcional fosfato (PO4) le da al ADN y al ARN la propiedad de un ácido a pH fisiológico, de ahí el nombre de ácido nucleico.

Pregunta 6.
Qué tipo de vínculo se forma

  1. entre una base de purina y pirimidina?
  2. entre el azúcar pentosa y el nucleótido adyacente?
  1. Las bases de purina y pirimidina están unidas por enlaces de hidrógeno.
  2. El azúcar pentosa está unido al nucleótido adyacente por enlaces fosfodiéster.

Pregunta 7.
El ADN actúa como material genético para la mayoría de los organismos vivos y no el ARN. Da razones para apoyar la afirmación.
Respuesta:

  1. El ARN era reactivo y, por tanto, muy inestable.
  2. Algunas moléculas de ARN actúan como reguladores de genes al unirse al ADN y afectar la expresión de genes.
  3. El uracilo de ARN es menos estable que la timina de ADN.

Pregunta 8.
Nombra dos virus cuyo material genético sea ARN.
Respuesta:

Pregunta 9.
¿Cuáles son las propiedades que debe poseer una molécula para actuar como material genético?
Respuesta:

  1. Autorreplicación
  2. Almacenamiento de informacion
  3. Estabilidad
  4. Variación por mutación

Pregunta 10.
¿Cuántos pares de bases están presentes en una vuelta completa de la hélice de ADN? ¿Cuál es la distancia entre dos pares de bases consecutivos?
Respuesta:
Hay diez pares de bases en cada turno con una distancia de 0,34 x 109 m entre dos pares de bases adyacentes.

Pregunta 11.
¿Qué es un genóforo?
Respuesta:
En procariotas como E. coli, aunque no tienen un núcleo definido, el ADN no está esparcido por toda la célula. El ADN (que tiene carga negativa) se mantiene con algunas proteínas (que tienen cargas positivas) en una región llamada nucleoide. El ADN como nucleoide está organizado en grandes bucles sostenidos por proteínas. El ADN de los procariotas es casi circular y carece de organización de cromatina, por lo que se denomina genóforo.

Pregunta 12.
¿Qué es el nucleosoma? ¿Cuántos pares de bases hay en un nucleosoma típico?
Respuesta:
El ADN cargado negativamente se envuelve alrededor del octamero de histonas cargadas positivamente para formar una estructura llamada nucleosoma. Un nucleosoma típico contiene 200 pb de hélice de ADN.

Pregunta 13.
Expandir y definir NHC
Respuesta:

  1. NHC: proteína cromosómica no histona.
  2. En eucariotas, además de las proteínas histonas, se requiere un conjunto adicional de proteínas para el empaquetamiento de la cromatina a un nivel superior y se denominan proteínas cromosómicas no histonas.

Pregunta 14.
Diferenciar entre heterocromatina y eucromatina.
Respuesta:
Heterocromatina:

  1. La región del núcleo donde la cromatina está suelta y las manchas claras se denominan heterocromatina.
  2. Transcripcionalmente inactivo.
  1. La región del núcleo donde la cromatina está compacta y las manchas oscuras se denominan eucromatina.
  2. Transcripcionalmente activo.

Pregunta 15.
¿Cuál es el modelo de replicación del ADN ampliamente aceptado? ¿Quién lo ha probado?
Respuesta:
Modelo de replicación semiconservador. Meselson y Stahl lo probaron en 1958.

Pregunta 16.
Nombra la sustancia química que recibe el nombre

  1. La ADN polimerasa I también se conoce como enzima de Komberg.
  2. La polinucleótido fosforilasa también se conoce como enzima de Ochoa.

Pregunta 17.
Nombra los distintos tipos de ADN polimerasa procariota. Indique su papel en el proceso de replicación.
Respuesta:

  1. ADN polimerasa I Involucionario en el mecanismo de reparación del ADN
  2. Involucionario de la ADN polimerasa II en el mecanismo de reparación del ADN
  3. Involver de la ADN polimerasa III en la replicación del ADN

Pregunta 18.
¿Cuál es la función del desoxi nucleótido trifosfato en la replicación?
Respuesta:
El desoxi nucleótido trifosfato actúa como sustrato y también proporciona energía para la reacción de polimerización.

Pregunta 19.
A continuación se presentan algunos eventos de replicación eucariota. Nombra las enzimas involucradas en el proceso.

  1. Desbobinado de ADN
  2. Unión de fragmentos de Okazaki
  3. Adición de nucleótidos a una nueva hebra.
  4. Corrigiendo la reparación

Pregunta 20.
Diferenciar la hebra principal de la hebra retrasada
Respuesta:
Filamento principal:

Pregunta 21.
¿Qué son los fragmentos de Okazaki?
Respuesta:
Los fragmentos sintetizados de forma discontinua de la hebra rezagada se denominan fragmentos de Okazaki que se unen mediante la enzima ADN ligasa.

Pregunta 22.
¿Qué es una bifurcación de replicación?
Respuesta:
En el punto de origen de la replicación, las helicasas y topoisomerasas (ADN girasa) desenrollan y separan las hebras, formando una estructura en forma de Y llamada horquilla de replicación. Hay dos bifurcaciones de replicación en cada origen.

Pregunta 23.
Aparte de la ADN polimerasa, nombre las otras cuatro enzimas que participaron en la replicación del ADN de la célula eucariota.
Respuesta:
ADN ligasa, topoisomerasa (ADN girasa), helicasa y nucleasa.

Pregunta 24.
¿Quién propuso el dogma central? Escribe su concepto.
Respuesta:
Francis Crick propuso el dogma central en biología molecular que establece que la información genética fluye de la siguiente manera:

Pregunta 25.
Defina la transcripción y nombre la enzima involucrada en este proceso.
Respuesta:
El proceso de copiar información genética de una hebra de ADN en ARN se denomina transcripción. Este proceso tiene lugar en presencia de ARN polimerasa dependiente de ADN.

Pregunta 26.
¿Qué es la caja TATA? Indique su función.
Respuesta:
En eucariotas, el promotor tiene regiones ricas en AT llamadas caja TATA o caja Goldberg-Hogness. Actúa como un sitio de unión para la ARN polimerasa.

Pregunta 27.
El gen estructural de los eucariotas se diferencia de los procariotas. ¿Cómo?
Respuesta:
En eucariotas, el gen estructural es monocistrónico que codifica solo una proteína, mientras que en los procariotas, el gen estructural es policistrónico que codifica muchas proteínas.

Pregunta 28.
¿Cuáles son los dos componentes principales de la ARN polimerasa procariota? ¿Cómo actúan?
Respuesta:
La ARN polimerasa bacteriana (procariota) consta de dos componentes principales, la enzima central y la subunidad sigma.La enzima central (β1, β y α) es responsable de la síntesis de ARN & # 8221, mientras que una subunidad sigma es responsable del reconocimiento del promotor.

Pregunta 29.
Distinguir entre exones e intrones.
Respuesta:

  1. Exones: secuencias expresadas (secuencias codificantes) de un gen eucariota
  2. Intrones: secuencias intervinientes (secuencias no codificantes) de un gen eucariota

Pregunta 30.
Definir empalme.
Respuesta:
El proceso de eliminación de intrones del hnRNA se llama empalme.

Pregunta 31.
¿Qué es tapping y tailing?
Respuesta:
Para tapar un nucleótido inusual, se agrega metil guanosina trifosfato en el extremo 5 'del hnRNA, mientras que los residuos de adenilato (200-300) (Poli A) se agregan en el extremo 3' de la cola.

Pregunta 32.
Si un ADN de doble hebra tiene un 20% de citosina, calcule el porcentaje de adenina en el ADN.
Respuesta:
Cytdsine = 20, por lo tanto, guanina = 20
Según la regla de Chargaf (A + T) = (G + C) = 100
Porcentaje de timina + adenina = 20 + 20 = 100
(T + A) = (20 + 20) = 100
(T + A) = 100- (20 + 20)
T + A = 100 y # 8211 40
T + A = 60
Por lo tanto, el porcentaje de adenina será 60/2 = 30%.

Pregunta 33.
Mencione las funciones duales de AUG.
Respuesta:
AUG tiene funciones duales. Actúa como un codón iniciador y también codifica el aminoácido metionina.

Pregunta 34.
¿Cuántos codones están implicados en la terminación de la traducción? Nómbralos.
Respuesta:
Tres codones terminan el proceso de traducción. Son UAA, UAG y UGA.

Pregunta 35.
Degeneración del codón & # 8211 comentario.
Respuesta:
Un código degenerado significa que más de un codón triplete podría codificar un aminoácido específico. Por ejemplo, codones GUU, GUC, GUA y código GUG para valina.

Pregunta 36.
Señale las categorías excepcionales a la universalidad del código genético.
Respuesta:
Se observan excepciones a la naturaleza universal del código genético en genomas procariotas mitocondriales y de cloroplasto.

Pregunta 37.
¿Qué son los codones sin sentido?
Respuesta:
UGA, UAA y UAG son los codones sin sentido, que terminan la traducción.

Pregunta 38.
Nombra los codones triplete que codifican

Pregunta 39.
¿Por qué el hnRNA tiene que someterse a un empalme?
Respuesta:
Dado que el hnRNA contiene tanto secuencias codificantes (exones) como secuencias no codificantes (intrones), tiene que someterse a un corte y empalme para eliminar los intrones.

Pregunta 40.
Indique el papel de los siguientes codones en el proceso de traducción.

Pregunta 41.
A continuación se muestra la secuencia de ARNm. Mencione la secuencia de aminoácidos que se forma después de su traducción.
Respuesta:
3’AUGAAAGAUGGGUAA5 ’
Metionina & # 8211 Lisina & # 8211 Ácido aspártico & # 8211 Glicina

Pregunta 42.
Nombra los cuatro codones que codifican la valina.
Respuesta:
GUU, GUC, GUA y GUG.

Pregunta 43.
La secuencia de bases en una de las cadenas de ADN es TAGC ATGAT. Mencione la secuencia de bases en su cadena complementaria.
Respuesta:
La hebra complementaria tiene ATCGTACTA.

Pregunta 44.
¿Por qué el t-ARN se denomina molécula adaptadora?
Respuesta:
La molécula de ARN de transferencia (ARNt) de una célula actúa como un vehículo que recoge los aminoácidos esparcidos por el citoplasma y también lee códigos específicos de moléculas de ARNm. De ahí que se le llame molécula adaptadora.

Pregunta 45.
¿Qué quiere decir con la carga de tRNA? Nombra la enzima involucrada en este proceso.
Respuesta:
El proceso de adición de aminoácidos al tRNA se conoce como aminoacilación o carga y el producto resultante se llama aminoacil-tRNA (tRNA cargado). La aminoacilación es catalizada por una enzima aminoacil y # 8211 tRNA sintetasa.

Pregunta 46.
¿Qué son las UTR?
Respuesta:
El ARNm también tiene algunas secuencias adicionales que no se traducen y se denominan Regiones no traducidas (UTR). Las UTR están presentes tanto en el extremo 5 '(antes del codón de inicio) como en el extremo 3' (después del codón de terminación).

Pregunta 47.
¿Qué es la secuencia S & # 8211 D?
Respuesta:
El extremo 5 'del ARNm de los procariotas tiene una secuencia especial que precede al codón de inicio AUG inicial del ARNm. Este sitio de unión al ribosoma se denomina secuencia Shine & # 8211 Dalgamo o secuencia S-D. Esta secuencia pares de bases con una región del ARN 16Sr de la subunidad ribosómica pequeña que facilita la iniciación.

Pregunta 48.
Definir unidad de traducción.
Respuesta:
Una unidad de traducción en el ARNm es la secuencia de ARN que está flanqueada por el codón de inicio en el extremo 5 'y el codón de terminación en el extremo 3' y los códigos del polipéptido.

Pregunta 49.
Mencione el papel inhibidor de la tetraciclina y la estreptomicina en la traducción bacteriana.
Respuesta:
La tetraciclina inhibe la unión entre el ARNm de aminoacilo y el ARNm. La estreptomicina inhibe el inicio de la traducción y provoca una lectura incorrecta.

Pregunta 50.
¿En qué etapa se regula la expresión génica?
Respuesta:
La expresión génica puede controlarse o regularse a niveles transcripcionales o traduccionales.

Pregunta 51.
¿Qué es un operón? Da un ejemplo.
Respuesta:
El grupo de genes con funciones relacionadas se llama operón.
Por ejemplo: operón lac en E. coli.

Pregunta 52.
Teniendo en cuenta el operón lac de E. coli, nombre los productos de los siguientes genes.

  1. i gen & # 8211 proteína represora
  2. gen lac Z y # 8211 fS-galactosidasa
  3. Gen Lac Y & # 8211 Permease
  4. lac a gen y # 8211 transacetilasa

Pregunta 54.
Nombra el cromosoma humano que tiene

  1. El cromosoma 1 tiene el número máximo de genes (2968 genes)
  2. El cromosoma Y tiene menos genes (231 genes)

Pregunta 55.
¿Qué son los SNP? Mencione sus usos.
Respuesta:
SNP: polimorfismo de un solo nucleótido. Ayuda a encontrar ubicaciones cromosómicas para secuencias asociadas a enfermedades y rastrear la historia humana.

Pregunta 56.
Mencione cuatro áreas en las que se pueden utilizar las huellas dactilares de ADN.
Respuesta:

  1. Análisis forense
  2. Análisis de pedigrí
  3. Conservación de la vida salvaje
  4. Estudios antropológicos

Pregunta 57.
Clasifica el ácido nucleico según las moléculas de azúcar.
Respuesta:
Hay dos tipos de ácidos nucleicos según el tipo de azúcar pentosa. Los que contienen azúcar desoxirribosa se denominan ácido desoxirribonucleico (ADN) y los que contienen azúcar ribosa se conocen como ácido ribonucleico (ARN). La única diferencia entre estos dos azúcares es que hay un átomo de oxígeno menos en la desoxirribosa.

Pregunta 58.
Tanto las purinas como las pirimidinas son bases nitrogenadas, pero difieren. ¿Cómo?
Respuesta:
Tanto las purinas como las pirimidinas son bases nitrogenadas. Las bases de purina adenina y guanina tienen un anillo de nitrógeno de carbono doble y # 8211, mientras que las bases de citosina y timina tienen un anillo de nitrógeno de carbono único.

Pregunta 59.
¿En qué se diferencia el 5 'de ADN de su 3'?
Respuesta:
El 5 ’del ADN se refiere al carbono del azúcar al que está unido el grupo funcional fosfato (P04V). El 3 'del ADN se refiere al carbono del azúcar al que está unido un grupo hidroxilo (OH).

Pregunta 60.
Estado de la regla de Chargaff.
Respuesta:
Según Erwin Chargaff,

  1. La adenina se empareja con la timina con dos enlaces de hidrógeno.
  2. La guanina se empareja con la citosina con tres enlaces de hidrógeno.

Pregunta 61.
Químicamente, el ADN es más estable que el ARN & # 8211 Justificar.
Respuesta:
En el ADN, las dos hebras son complementarias, si se separan (desnaturalizan) por calentamiento pueden unirse (renaturalización) cuando se proporciona la condición apropiada. Además, el grupo 2 OH presente en cada nucleótido del ARN es un grupo reactivo que hace que el ARN sea responsable y fácilmente degradable. También se sabe que el ARN es catalítico y reactivo. Por tanto, el ADN es químicamente más estable y químicamente menos reactivo en comparación con el ARN. La presencia de timina en lugar de uracilo en el ADN confiere estabilidad adicional al ADN.

Pregunta 62.
Escriba en forma simple sobre el modo semiconservador de replicación del ADN.
Respuesta:
La replicación semiconservadora fue propuesta por Watson y Crick en 1953. Este mecanismo de replicación se basa en el modelo de ADN. Sugirieron que las dos cadenas de polinucleótidos de la molécula de ADN se desenrollaran y comenzaran a separarse en un extremo. Durante este proceso, se rompen los enlaces de hidrógeno covalentes. La hebra única separada actúa luego como plantilla para la síntesis de una nueva hebra. Posteriormente, cada doble hélice hija lleva una hebra de polinucleótidos de la molécula madre que actúa como molde y la otra hebra se sintetiza nuevamente y es complementaria a la hebra parental.

Pregunta 63.
Dibuja un diagrama simplificado del nucleosoma y etiquétalo.
Respuesta:

Pregunta 64.
¿Qué es una cartilla?
Respuesta:
Un cebador es un tramo corto de ARN. Inicia la formación de una nueva hebra. El cebador produce el extremo 3'-OH en la secuencia de ribonucleótidos, a los que se agregan desoxirribonucleótidos para formar una nueva hebra.

Pregunta 65.
Ambas cadenas de ADN no se copian durante la transcripción. Dar una razon.
Respuesta:
Ambas cadenas de ADN no se copian durante la transcripción por dos razones.

  1. Si ambas cadenas actúan como plantilla, codificarían ARN con diferentes secuencias. Esto, a su vez, codificaría proteínas con diferentes secuencias de aminoácidos. Esto daría lugar a que un segmento de ADN codificara dos proteínas diferentes, lo que complicaría la maquinaria de transferencia de información genética.
  2. Si se produjeran dos moléculas de ARN simultáneamente, se formaría ARN bicatenario complementario entre sí. Esto evitaría que el ARN se traduzca en proteínas.

Pregunta 66.
¿Qué quiere decir con una cadena de plantilla y una cadena de codificación?
Respuesta:
La ARN polimerasa dependiente de ADN cataliza la polimerización en una sola dirección, la hebra que tiene la polaridad 3 '→ 5' actúa como plantilla y se denomina hebra plantilla. La otra hebra que tiene la polaridad 5 '→ 3' tiene la misma secuencia que el ARN (excepto timina en lugar de uracilo) y se desplaza durante la transcripción. Esta hebra se llama hebra codificante.

Pregunta 67.
Nombre los factores que son responsables del inicio y finalización de la transcripción en procariotas.
Respuesta:

  1. El factor sigma es responsable del inicio de la transcripción.
  2. El factor Rho es responsable de la terminación de la transcripción.

Pregunta 68.
Nombra los principales tipos de ARN de procariotas y menciona su función.
Respuesta:
En los procariotas, hay tres tipos principales de ARN: ARNm, ARNt y ARNr. Los tres ARN son necesarios para sintetizar una proteína en una célula. El ARNm proporciona la plantilla, el ARNt aporta aminoácidos y lee el código genético, y los ARNr juegan un papel estructural y catalítico.
durante la traducción.

Pregunta 69.
Definir código genético.
Respuesta:
El orden de los pares de bases a lo largo de la molécula de ADN controla el tipo y el orden de los aminoácidos que se encuentran en las proteínas de un organismo. Este orden específico de pares de bases se llama código genético.

Pregunta 70.
Explica la hipótesis de Wobble.
Respuesta:
La hipótesis de la oscilación es propuesta por Crick (1966), que establece que el anticodón del ARNt tiene la capacidad de oscilar en su extremo 5 'al emparejarse incluso con una base no complementaria del codón de ARNm. & # 8217 De acuerdo con esta hipótesis, en el emparejamiento de codón-anticodón el La tercera base puede no ser complementaria.

La tercera base del codón se llama base de oscilación y esta posición se llama posición de oscilación. El emparejamiento de bases real se produce solo en las dos primeras posiciones. La importancia de la hipótesis de Wobbling es que reduce el número de ARNt necesarios para la síntesis de polipéptidos y supera el efecto de la degeneración del código.

Pregunta 71.
Explica la naturaleza del ribosoma eucariota.
Respuesta:
Los ribosomas de los eucariotas (80 S) son más grandes y constan de subunidades 60 S y 40 S. "S" denota la sedimentación eficiente que se expresa como unidad de Svedberg (S). La subunidad más grande en eucariotas consiste en una molécula de ARN 23 S y ARN 5Sr y 31 proteínas ribosómicas. La subunidad eucariota más pequeña consta de un componente de ARN 18Sr y aproximadamente 33 proteínas.

Pregunta 72.
Expanda y defina ORF.
Respuesta:
Cualquier secuencia de ADN o ARN que comience con un codón de inicio y que pueda traducirse en una proteína se conoce como marco de lectura abierto (ORF).

Pregunta 73.
¿Cuáles son los componentes del complejo de iniciación de la traducción procariota?
Respuesta:
El inicio de la traducción en E. coli comienza con la formación de un complejo de iniciación, que consta de las subunidades 30S del ribosoma, un ARN mensajero y el ARNt de N-formil metionina cargado (f met -1 ARN f met), tres factores de iniciación proteicos (IF 1, IF2, IF3), GTP (Trifosfato Guaniner) y Mg 2+.

Pregunta 74.
Explica los componentes del operón.
Respuesta:
Estructura del operón: cada operón es una unidad de expresión y regulación génica y consta de
de uno o más genes estructurales y un gen operador adyacente que controla la transcripción
actividad del gen estructural.

  1. El gen estructural codifica proteínas, rRNA y tRNA requeridos por la célula.
  2. Los promotores son las secuencias señal en el ADN que inician la síntesis de ARN. La ARN polimerasa I se une al promotor antes del inicio de la transcripción.
  3. Los operadores están presentes entre los promotores y los genes estructurales. La proteína represora se une a la región operadora del operón.

Pregunta 75.
Describe el experimento de Hershey y Chase. ¿Qué concluye su experimento?
Respuesta:
Alfred Hershey y Martha Chase (1952) realizaron experimentos con bacteriófagos que infectan bacterias. Fago T2 es un virus que infecta a la bacteria Escherichia coli. Cuando se agregan fagos (virus) a las bacterias, se adsorben en la superficie exterior, parte del material ingresa a la bacteria y luego cada bacteria se lisa para liberar una gran cantidad de fagos de la progenie. Hershey y Chase querían observar si era el ADN o la proteína lo que entraba en la bacteria. Todos los ácidos nucleicos contienen fósforo y azufre (en el aminoácido cisteína y metionina). Hershey y Chase diseñaron un experimento utilizando isótopos radiactivos de azufre (35 S) y fósforo (32 P) para realizar un seguimiento separado de la proteína viral y los ácidos nucleicos durante el proceso de infección.

Se permitió que los fagos infectaran bacterias en un medio de cultivo que contenía los isótopos radiactivos 35 S o 32 P. El bacteriófago que creció en presencia de 35 S tenía proteínas marcadas y los bacteriófagos cultivados en presencia de 32 P tenían ADN marcado. Por tanto, el marcaje diferencial les permitió identificar el ADN y las proteínas del fago. Hershey y Chase mezclaron los fagos marcados con E. coli sin marcar y permitieron que los bacteriófagos atacaran e inyectaran su material genético. Poco después de la infección (antes de la lisis de las bacterias), las células bacterianas se agitaron suavemente en un mezclador para aflojar las partículas de la fase adherida.

Se observó que solo se encontró 32 P asociado con células bacterianas y 35 S en el medio circundante y no en las células bacterianas. Cuando se estudió la radioactividad de la progenie del fago, se encontró que solo portaba 32 P y no 35 S. Estos resultados indican claramente que solo el ADN y no la cubierta proteica ingresaron a las células bacterianas. Así, Hershey y Chase demostraron de manera concluyente que era el ADN, no la proteína, lo que transportaba la información hereditaria de virus a bacterias.

Pregunta 76.
Explica las propiedades del ADN que lo convierten en un material genético ideal.
Respuesta:
1. Autorreplicación: debería poder replicarse. De acuerdo con la regla de apareamiento y complementariedad de bases, ambos ácidos nucleicos (ADN y ARN) tienen la capacidad de dirigir duplicaciones. Las proteínas no cumplen con este criterio.

2. Estabilidad: Debe ser estable estructural y químicamente. El material genético debe ser lo suficientemente estable para no cambiar con las diferentes etapas del ciclo de vida, la edad o con los cambios en la fisiología del organismo. La estabilidad como propiedad del material genético era claramente evidente en el principio transformador de Griffith. El calor que mató a las bacterias no destruyó algunas de las propiedades del material genético. En el ADN, las dos hebras son complementarias.

si se separan (desnaturalizan) por calentamiento, pueden unirse (renaturalización) cuando se proporcionan las condiciones adecuadas. Además, el grupo 2 ’OH presente en cada nucleótido del ARN es un grupo reactivo que hace que el ARN sea susceptible y fácilmente degradable. También se sabe que el ARN es catalítico y reactivo. Por tanto, el ADN es químicamente más estable y químicamente menos reactivo en comparación con el ARN. La presencia de timina en lugar de uracilo en el ADN confiere estabilidad adicional al ADN.

3. Almacenamiento de información: debe poder expresarse en forma de "caracteres mendelianos". El ARN puede codificar directamente la síntesis de proteínas y puede expresar fácilmente los caracteres. El ADN, sin embargo, depende del ARN para la síntesis de proteínas. Tanto el ADN como el ARN pueden actuar como material genético, pero el ADN, que es más estable, almacena la información genética y el ARN transfiere la información genética.

4. Variación por mutación: debería poder mutar. Tanto el ADN como el ARN pueden mutar. El ARN es inestable y muta a un ritmo más rápido. Por lo tanto, los virus que tienen un genoma de ARN con una vida útil más corta pueden mutar y evolucionar más rápido. La discusión anterior indica que tanto el ARN como el ADN pueden funcionar como material genético. El ADN es más estable y se prefiere para el almacenamiento de información genética.

Pregunta 77.
¿Cómo se empaqueta el ADN en una célula eucariota? pie
Respuesta:
En eucariotas, la organización es más compleja. La cromatina está formada por una serie de unidades repetidas llamadas nucleosomas. Komberg propuso un modelo para el nucleosoma, en el que 2 moléculas de las cuatro proteínas histonas H2A, H2B, H3 y H4 se organizan para formar una unidad de ocho moléculas llamada histona octamere. El ADN cargado negativamente se envuelve alrededor del octamero de histonas cargadas positivamente para formar una estructura llamada nucleosoma. Un nucleosoma típico contiene 200 pb de hélice de ADN. Los octameros de histonas están en estrecho contacto y el ADN está enrollado en el exterior del nucleosoma. Los nucleosomas vecinos están conectados por ADN enlazador (HI) que está expuesto a enzimas.

El ADN hace dos vueltas completas alrededor de los octameros de histona y las dos vueltas están selladas por una molécula de HI. La cromatina que carece de HI tiene una apariencia de perlas en una cuerda en la que el ADN se interpone y abandona los nucleosomas en lugares aleatorios. El HI de un nucleosoma puede interactuar con 33 l de los nucleosomas vecinos dando como resultado un mayor plegamiento de la fibra.

La fibra de crof y ampatina en núcleos en interfase y cromosomas mitóticos tiene un diámetro que varía entre 200-300 nm y representa cromatina inactiva. La fibra de 30 nm surge del plegado de nucfeosbme, cadenas en una estructura de solenoide que tiene seis nucleosomas por vuelta. Esta estructura se estabiliza mediante la interacción entre diferentes moléculas de HI. El ADN es un solenoide y está empaquetado,%) _ pliegues. Se ilustra la naturaleza jerárquica de la estructura cromosómica.

Se requiere un conjunto adicional de pteínas para el empaquetamiento de cromatina a un nivel superior y se denominan proteínas cromosómicas no histonas (NHC). En *, un núcleo típico, algunas regiones de la cromatina están empaquetadas con Ibosely (ligeramente teñidas) y se denominan eucromatina. La cromatina que está compactada (teñida de forma oscura) se llama heterocromatina. La eucromatina es transcripcionalmente activa y la heterocromatina es transcripcionalmente inactiva.

Pregunta 78.
El experimento de Meselson y Stahl demostró el modo de replicación del ADN de semicofptervación. Explicar.
Respuesta:
El modo de replicación del ADN fue determinado en 1958 por Meselson y Stahl.Diseñaron un experimento para distinguir entre réplicas semiconservadoras, conservadoras y dispersivas. En su experimento, cultivaron dos culturas de E. coli durante muchas generaciones en medios separados. El cultivo "pesado" se hizo crecer en un medio en el que la fuente de nitrógeno (NH4CI) contenía el isótopo pesado 15 N y el cultivo "ligero" se cultivó en un medio en el que la fuente de nitrógeno contenía el isótopo ligero 14 H durante muchas generaciones. Al final del crecimiento, observaron que el ADN bacteriano en el cultivo pesado contenía solo 15 N y en el cultivo ligero solo 14 N. El ADN pesado se pudo distinguir del ADN ligero (15 N de 14 N) con una técnica llamada Cesio. Centrifugación en gradiente de densidad de cloruro (CsCl). En este proceso, el ADN pesado y liviano extraído de las células en trece cultivos se asentaron en dos bandas distintas y separadas (ADN híbrido).

El cultivo pesado (15 N) se transfirió luego a un medio que solo tenía NH4Cl y se tomaron muestras en varios intervalos de tiempo definidos (20 minutos de duración). Después de la primera replicación, extrajeron el ADN y lo sometieron a centrifugación en gradiente de densidad. El ADN se instaló en una banda que tenía una posición intermedia entre las bandas pesadas y ligeras determinadas previamente. Después de la segunda replicación (40 minutos de duración), nuevamente extrajeron muestras de ADN, y esta vez encontraron que el ADN se asentaba en dos bandas, una en la posición de la banda clara y otra en la posición intermedia. Estos resultados confirman la hipótesis de replicación semi & # 8211 conservadora de Watson y Crick.

Pregunta 79.
Dar una descripción detallada de una unidad de transcripción.
Respuesta:
Una unidad transcripcional en el ADN está definida por tres regiones, un promotor, el gen estructural y un terminador. El promotor se encuentra hacia el extremo 5 '. Es una secuencia de ADN que proporciona un sitio de unión para la ARN polimerasa. La presencia de promotor en una unidad de transcripción define la plantilla y las cadenas codificantes. La región del terminador ubicada hacia el extremo 3 'de la cadena codificante contiene una secuencia de ADN que hace que la ARN polimerasa deje de transcribir. En eucariotas, el promotor tiene regiones ricas en AT llamadas caja TATA (caja de Goldberg-Hogness) & # 8216 y en procariotas esta región se llama caja de Pribnow.

Además del promotor, los eucariotas también requieren un potenciador. Las dos hebras del ADN en el gen estructural de una unidad de transcripción tienen polaridad opuesta. La ARN polimerasa dependiente de ADN cataliza la polimerización en una sola dirección, la hebra que tiene la polaridad 3 '→ 5' actúa como plantilla y se denomina hebra plantilla. La otra hebra que tiene la polaridad 5 '→ 3' tiene la misma secuencia que el ARN (excepto timina en lugar de uracilo) y se desplaza durante la transcripción. Esta hebra se llama hebra codificante

El gen estructural puede ser monocistrónico (eucariotas) o policistrónico (procariotas). En eucariotas, cada ARNm lleva solo un gen y codifica información para una sola proteína y se llama ARNm monocistrónico. En los procariotas, los grupos de genes relacionados, conocidos como operón, que a menudo se encuentran uno al lado del otro en el cromosoma, se transcriben juntos para dar un solo ARNm y, por lo tanto, son policistrónicos.

Pregunta 80.
Explique el proceso de transcripción en procariotas con el diagrama necesario.
Respuesta:
En los procariotas, hay tres tipos principales de ARN:
ARNm, ARNt y ARNr. Los tres ARN son necesarios para sintetizar una proteína en una célula. El ARNm proporciona la plantilla, el ARNt aporta aminoácidos y lee el código genético, y los ARNr desempeñan un papel estructural y catalítico durante la traducción. Existe una única ARN polimerasa dependiente de ADN que cataliza la transcripción de todos los tipos de ARN. Se une al promotor e inicia la transcripción (iniciación).

Los sitios de unión de las polimerasas se denominan promotores. Utiliza nucleósido trifosfato como sustrato y polimerasas de forma dependiente de la plantilla siguiendo la regla de complementariedad. Después del inicio de la transcripción, la polimerasa continúa alargando el ARN, agregando un nucleótido tras otro a la cadena de ARN en crecimiento. Solo un tramo corto de ARN permanece unido a la enzima, cuando la polimerasa alcanza un terminador al final de un gen, el ARN naciente se cae, y también la ARN polimerasa. La ARN polimerasa solo es capaz de catalizar el proceso de alargamiento. La ARN polimerasa se asocia transitoriamente con el factor de iniciación sigma (a) y el factor de terminación rho (p) para iniciar y terminar la transcripción, respectivamente.

La asociación de ARN con estos factores instruye a la ARN polimerasa para iniciar o terminar el proceso de transcripción. En las bacterias, dado que el ARNm no requiere ningún procesamiento para activarse y también dado que la transcripción y la traducción tienen lugar simultáneamente en el mismo compartimento (ya que no hay separación del citosol y el núcleo en las bacterias), muchas veces la traducción puede comenzar mucho antes de que el ARNm sea eliminado. totalmente transcrito. Esto se debe a que el material genético no está separado de otros orgánulos celulares por una membrana nuclear, por lo que la transcripción y la traducción pueden acoplarse en bacterias.

Pregunta 81.
Escribe las características más destacadas del código genético.
Respuesta:
Las características más destacadas del código genético son las siguientes:

  1. El codón genético es un código triplete y 61 codones codifican aminoácidos y 3 codones no codifican ningún aminoácido y funcionan como codón de terminación (terminación).
  2. El código genético es universal. Significa que todos los sistemas vivos conocidos usan ácidos nucleicos y los mismos codones de tres bases (codón triplete) dirigen la síntesis de proteínas a partir de aminoácidos. Por ejemplo, el codón del ARNm (UUU) codifica la fenilalanina en todas las células de todos los organismos. Se informan algunas excepciones en genomas procarióticos, mitocondriales y de cloroplasto. Sin embargo, las similitudes son más comunes que las diferencias.
  3. Un codón no superpuesto significa que no se usa la misma letra para dos codones diferentes. Por ejemplo, la secuencia de nucleótidos GUTJ y GUC representa solo dos codones.
  4. No tiene comas, lo que significa que el mensaje se leería directamente de un extremo al otro, es decir, no se necesitan signos de puntuación entre dos códigos.
  5. Un código degenerado significa que más de un codón triplete podría codificar un aminoácido específico. Por ejemplo, codones GUU, GUC, GUA y código GUG para valina.
  6. El código no ambiguo significa que un codón codificará un aminoácido.
  7. El código siempre se lee en una dirección fija, es decir, desde 5 '→ 3' dirección llamada polaridad.
  8. AUG tiene funciones duales. Actúa como un codón iniciador y también codifica el aminoácido metionina.
  9. Los codones UAA, UAG (tirosina) y UGA (triptófano) se designan como codones de terminación (terminación) y también se conocen como codones "sin sentido".

Pregunta 82.
Las mutaciones en el código genético afectan el fenotipo. Describe con un ejemplo.
Respuesta:
El tipo más simple de mutación a nivel molecular es un cambio de nucleótido que sustituye una base por otra. Tales cambios se conocen como sustituciones de bases que pueden ocurrir espontáneamente o debido a la acción de mutágenos. Un ejemplo bien estudiado es la anemia de células falciformes en humanos, que resulta de una mutación puntual de un alelo del gen de la β-hemoglobina (βHb).

Una molécula de hemoglobina consta de cuatro cadenas polipeptídicas de dos tipos, dos cadenas a y dos cadenas P. Cada cadena tiene un grupo hemo en su superficie. Los grupos hemo están involucrados en la unión de oxígeno. La enfermedad de la sangre de Jruman, la anemia de células falciformes, se debe a una hemoglobina anormal. Esta anomalía en la hemoglobina se debe a una sustitución de una sola base en el sexto codón del gen beta globingen de GAG ​​a GTG en la cadena p de la hemoglobina.

Da como resultado un cambio del aminoácido ácido glufeniico a valina en la sexta posición de la cadena p. Este es el ejemplo clásico de mutación puntual que da como resultado el cambio del residuo de aminoácidos ácido glutámico a valina. La hemoglobina mutante sufre una polimerización bajo tensión de oxígeno provocando el cambio en la forma de los glóbulos rojos de bicóncava a una estructura en forma de hoz.

Pregunta 83.
Explique el mecanismo de AteArperon de la E-coli.
Respuesta:
El operón Lac (lactosa): el metabolismo de la lactosa en E. coli requiere tres enzimas: permeasa, P-galactosidasa (P-gat) y transacetilasa. La enzima permeasa es necesaria para la entrada de lactosa en la célula, la Pjgglactosidasa provoca la hidrólisis de lactosa a glucosa y galactosa, mientras que la transacetilatransfiere el grupo acetilo de acetil Co A a P-galactosidasa. El operón lac consta de un gen regulador (el gen T se refiere al inhibidor), sitios promotores (p) y sitio operador (o). Además de estos, tiene tres genes estructurales a saber, lac z, y y lac a. El gen lac "z" codifica la P-gaiaqtttsidasa, el gen lac "y" codifica la permeasa y el gen "a" codifica la transacetilasa.

Jacob y Monod propusieron el modelo clásico del operón Lac para explicar la expresión y regulación génica en E. coli. En lac, un gen estructural policistrónico está regulado por un promotor común y genfc regulador. Cuando la célula usa su fuente de energía normal como glucosa, el gen "i" transcribe un ARNm represor y, después de su traducción, se produce una proteína represora. Se une a la región operadora del operón e impide la traducción, como resultado, no se produce P-galactosidasa. En ausencia de una fuente de carbono preferida, como la glucosa, si la lactosa está disponible como fuente de energía para las bacterias, la lactosa entra en la célula como resultado de la enzima permeasa. La lactosa actúa como inductor e interactúa con el represor para inactivarlo.

La proteína represora se une al operador del operón y evita que la ARN polimerasa transcriba el operón. En presencia de un inductor, como lactosa o alolactosa, el represor se inactiva por interacción con el inductor. Esto permite que la ARN polimerasa se una al sitio del promotor y transcriba el operón para producir ARNm de lac que permite la formación de todas las enzimas necesarias para el metabolismo de la lactosa. Esta regulación del operón lac por el represor es un ejemplo de control negativo del inicio de la transcripción.

Pregunta 84.
¿Cuáles son los objetivos del proyecto Genoma Humano?
Respuesta:
Los principales objetivos del Proyecto Genoma Humano son los siguientes:

  1. Identifique todos los genes (aproximadamente 30000) en el ADN humano.
  2. Determine la secuencia de los tres mil millones de pares de bases químicas que componen el ADN humano.
  3. Almacenar esta información en bases de datos.
  4. Mejorar las herramientas para el análisis de datos.
  5. Transferir tecnologías relacionadas a otros sectores, como industrias.
  6. Abordar las cuestiones éticas, legales y sociales (ELSI) que puedan surgir del proyecto.

Pregunta 85.
Escribe las características más destacadas del Proyecto Genoma Humano.
Respuesta:

  1. Aunque el genoma humano contiene 3 mil millones de bases de nucleótidos, las secuencias de ADN que codifican proteínas constituyen solo alrededor del 5% del genoma.
  2. Un gen promedio consta de 3000 bases, el gen humano más grande conocido es la distrofina con 2,4 millones de bases.
  3. La función del 50% del genoma se deriva de elementos transponibles como la secuencia LINE y ALU.
  4. Los genes se distribuyen en 24 cromosomas. El cromosoma 19 tiene la mayor densidad genética. El cromosoma 13 y el cromosoma Y tienen las densidades de genes más bajas.
  5. La organización cromosómica de los genes humanos muestra diversidad.
  6. Puede haber 35000-40000 genes en el genoma y casi 99,9 bases de nucleótidos son exactamente iguales en todas las personas.
  7. Se desconocen las funciones de más del 50 por ciento de los genes descubiertos.
  8. Menos del 2 por ciento del genoma codifica proteínas.
  9. Las secuencias repetidas constituyen una gran parte del genoma humano. Las secuencias repetitivas no tienen funciones de codificación directa, pero arrojan luz sobre la estructura, dinámica y evolución de los cromosomas (diversidad genética).
  10. El cromosoma 1 tiene 2968 genes, mientras que el cromosoma 'Y' tiene 231 genes.
  11. Los científicos han identificado alrededor de 1,4 millones de ubicaciones, donde las diferencias de ADN de una sola base (SNP & # 8211 Polimorfismo de nucleótido único & # 8211 se pronuncian como "snips") ocurren en humanos. La identificación de "SNIPS" es útil para encontrar ubicaciones cromosómicas para secuencias asociadas a enfermedades y rastrear la historia humana.

Pregunta 86.
Describe el principio involucrado en la técnica de huellas dactilares de ADN.
Respuesta:
La técnica de toma de huellas dactilares de ADN fue desarrollada por primera vez por Alec Jeffreys en 1985. El ADN de una persona y las huellas dactilares son únicos. Hay 23 pares de cromosomas humanos con 1,5 millones de pares de genes. Es un hecho bien conocido que los genes son segmentos de ADN que difieren en la secuencia de sus nucleótidos. No todos los segmentos de ADN codifican proteínas, algunos segmentos de ADN tienen una función reguladora, mientras que otros son secuencias intermedias (intrones) y otros son secuencias de ADN repetidas. En la toma de huellas dactilares de ADN, las secuencias de nucleótidos cortas y repetitivas son específicas de una persona. Estas secuencias de nucleótidos se denominan repeticiones en tándem de número variable (VNTR). Los VNTR de dos personas generalmente muestran variaciones y son útiles como marcadores genéticos.

La impresión digital de ADN implica identificar diferencias en algunas regiones específicas de la secuencia de ADN llamadas ADN repetitivo, porque en estas secuencias, un pequeño tramo de ADN se repite muchas veces. Este ADN repetitivo se separa del ADN genómico en masa como picos diferentes durante la centrifugación en gradiente de densidad. El ADN en masa forma un pico principal y los otros picos pequeños se denominan ADN satélite. Dependiendo de la composición de la base (rica en A: T o rica en G: C), la longitud del segmento y el número de unidades repetitivas, el ADN del satélite se clasifica en muchas subcategorías como microsatélites y minisatélites, etc.

Estas secuencias no codifican ninguna proteína, pero forman una gran parte del genoma humano. Estas secuencias muestran un alto grado de polimorfismo y forman la base de las huellas dactilares del ADN. El ADN aislado de sangre, cabello, células de la piel u otras evidencias genéticas dejadas en la escena de un crimen se puede comparar a través de patrones VNTR, con el ADN de un sospechoso criminal para determinar la culpabilidad o inocencia. Los patrones VNTR también son útiles para establecer la identidad de una víctima de homicidio, ya sea a partir del ADN encontrado como evidencia o del propio cuerpo.

Pregunta 87.
Dibuje un diagrama de flujo que represente los pasos de la técnica de huellas dactilares de ADN
Respuesta:

Preguntas sobre habilidades de pensamiento de orden superior (HOT)

Pregunta 1.
Una hebra de ARNm tiene una serie de codones tripletes, de los cuales los primeros tres codones se dan a continuación.
(a) AGOSTO
(b) UUU
(c) CGU
(i) Nombre el aminoácido codificado por estos codones triplete.
(ii) ¿Menciona la secuencia de ADN a partir de la cual se habrían transcrito estos tripletes de codones?
Respuesta:
(i) Códigos AUG para metionina
Códigos UUU para fenilalanina
Códigos UGC para cisteína
(ii) La secuencia de ADN de TAC se transcribe a AUG
La secuencia AAA de ADN se transcribe a UUU
La secuencia de ADN de ACG se transcribe a UGC

Pregunta 2.
A continuación se muestran las estructuras de las moléculas de ARNt que participan en el proceso de traducción. En un ARNt, se menciona el codón pero no el aminoácido. En otra molécula de ARNt, se nombra el aminoácido y no el codón. Complete la figura mencionando los respectivos aminoácidos y codones.
Respuesta:

Pregunta 3.
Un fragmento de ADN posee 32 bases de adenina y 32 bases de citosina. ¿Cuántos nucleótidos en total contiene ese fragmento de ADN? Explicar.
Respuesta:
128 nucleótidos. Adenine siempre empareja la base de Thymine. Si hay 32 bases de adenina, entonces debe haber 32 bases de timina. De manera similar, la citosina se empareja con la guanina. Si las bases de citosina son 32 en número, las bases de guanina serán iguales a la citosina. Entonces hace un total de 128 nucleótidos.

Pregunta 4.
A continuación se muestra una secuencia de ADN que representa una parte del gen TAC TCG CCC TAT UAA CCC AAA ACC TCT utilizando esta derivación A.


66 Base histórica del entendimiento moderno

Al final de esta sección, podrá hacer lo siguiente:

  • Explicar la transformación del ADN.
  • Describir los experimentos clave que ayudaron a identificar que el ADN es el material genético.
  • Enunciar y explicar las reglas de Chargaff.

Nuestra comprensión actual del ADN comenzó con el descubrimiento de ácidos nucleicos seguido del desarrollo del modelo de doble hélice. En la década de 1860, Friedrich Miescher ((Figura)), médico de profesión, aisló sustancias químicas ricas en fosfato de los glóbulos blancos (leucocitos). Él nombró a estos químicos (que eventualmente se conocerían como ADN) nucleina porque se aislaron de los núcleos de las células.


Para ver a Miescher realizar su experimento que lo llevó a descubrir el ADN y las proteínas asociadas en el núcleo, haga clic en esta revisión.

Medio siglo después, en 1928, el bacteriólogo británico Frederick Griffith informó de la primera demostración de transformación bacteriana, un proceso en el que una célula absorbe el ADN externo, cambiando así su morfología y fisiología. Griffith realizó sus experimentos con Steotococos neumonia, una bacteria que causa neumonía. Griffith trabajó con dos cepas de esta bacteria llamadas rugosa (R) y suave (S). (Los dos tipos de células se denominaron "rugosas" y "lisas" después de la aparición de sus colonias cultivadas en una placa de agar nutritivo).

La cepa R no es patógena (no causa enfermedad). La cepa S es patógena (causa de enfermedad) y tiene una cápsula fuera de su pared celular. La cápsula permite que la célula escape a las respuestas inmunitarias del ratón huésped.

Cuando Griffith inyectó la cepa S viva en ratones, murieron de neumonía. Por el contrario, cuando Griffith inyectó la cepa R viva en ratones, sobrevivieron. En otro experimento, cuando inyectó a ratones con la cepa S muerta por calor, también sobrevivieron. Este experimento mostró que la cápsula por sí sola no fue la causa de la muerte. En una tercera serie de experimentos, se inyectó a ratones una mezcla de cepa R viva y cepa S muerta por calor y, para su sorpresa, los ratones murieron. Tras aislar las bacterias vivas del ratón muerto, solo se recuperó la cepa de bacterias S. Cuando se inyectó esta cepa S aislada en ratones frescos, los ratones murieron. Griffith concluyó que algo había pasado de la cepa S muerta por calor a la cepa R viva y la transformó en la cepa S patógena. Llamó a esto el principio transformador ((Figura)). Estos experimentos se conocen ahora como experimentos de transformación de Griffith.


Los científicos Oswald Avery, Colin MacLeod y Maclyn McCarty (1944) estaban interesados ​​en explorar más este principio transformador. Aislaron la cepa S de los ratones muertos y aislaron las proteínas y los ácidos nucleicos (ARN y ADN), ya que eran posibles candidatos para la molécula de la herencia. Usaron enzimas que degradaban específicamente cada componente y luego usaron cada mezcla por separado para transformar la cepa R. Descubrieron que cuando el ADN se degradaba, la mezcla resultante ya no podía transformar las bacterias, mientras que todas las demás combinaciones podían transformar las bacterias. Esto los llevó a concluir que el ADN era el principio transformador.

Científico forense Los científicos forenses utilizaron pruebas de análisis de ADN por primera vez para resolver un caso de inmigración. La historia comenzó con un adolescente que regresaba a Londres desde Ghana para estar con su madre. Las autoridades de inmigración en el aeropuerto sospecharon de él, pensando que viajaba con un pasaporte falso. Después de mucha persuasión, se le permitió irse a vivir con su madre, pero las autoridades de inmigración no abandonaron el caso en su contra. Se proporcionaron a las autoridades todo tipo de pruebas, incluidas fotografías, pero no obstante se iniciaron los procedimientos de deportación. Casi al mismo tiempo, el Dr. Alec Jeffreys de la Universidad de Leicester en el Reino Unido había inventado una técnica conocida como huellas dactilares de ADN. Las autoridades de inmigración se acercaron al Dr. Jeffreys en busca de ayuda. Tomó muestras de ADN de la madre y tres de sus hijos, así como de una madre sin parentesco, y comparó las muestras con el ADN del niño. Debido a que el padre biológico no estaba en la imagen, el ADN de los tres niños se comparó con el ADN del niño. Encontró una coincidencia en el ADN del niño tanto para la madre como para sus tres hermanos. Llegó a la conclusión de que el niño era de hecho el hijo de la madre.

Los científicos forenses analizan muchos elementos, incluidos documentos, escritura a mano, armas de fuego y muestras biológicas. Analizan el contenido de ADN del cabello, el semen, la saliva y la sangre, y lo comparan con una base de datos de perfiles de ADN de delincuentes conocidos. El análisis incluye el aislamiento, la secuenciación y el análisis de secuencias de ADN. Se espera que los científicos forenses se presenten en las audiencias de la corte para presentar sus hallazgos. Por lo general, se emplean en los laboratorios de delitos de las agencias gubernamentales de la ciudad y el estado. Los genetistas que experimentan con técnicas de ADN también trabajan para organizaciones científicas y de investigación, industrias farmacéuticas y laboratorios universitarios. Los estudiantes que deseen seguir una carrera como científico forense deben tener al menos una licenciatura en química, biología o física, y preferiblemente algo de experiencia trabajando en un laboratorio.

Aunque los experimentos de Avery, McCarty y McLeod habían demostrado que el ADN era el componente informativo transferido durante la transformación, todavía se consideraba que el ADN era una molécula demasiado simple para transportar información biológica. Las proteínas, con sus 20 aminoácidos diferentes, se consideraron candidatos más probables. El experimento decisivo, realizado por Martha Chase y Alfred Hershey en 1952, proporcionó evidencia confirmatoria de que el ADN era de hecho el material genético y no las proteínas. Chase y Hershey estaban estudiando un bacteriófago, un virus que infecta a las bacterias. Los virus suelen tener una estructura simple: una cubierta de proteína, llamada cápside, y un núcleo de ácido nucleico que contiene el material genético (ya sea ADN o ARN). El bacteriófago infecta la célula bacteriana huésped al adherirse a su superficie y luego inyecta sus ácidos nucleicos dentro de la célula. El ADN del fago hace múltiples copias de sí mismo utilizando la maquinaria del huésped y, finalmente, la célula huésped estalla, liberando una gran cantidad de bacteriófagos. Hershey y Chase seleccionaron elementos radiactivos que distinguirían específicamente la proteína del ADN en las células infectadas. Etiquetaron un lote de fagos con azufre radiactivo, 35 S, para marcar la cubierta de proteína. Otro lote de fagos se marcó con fósforo radiactivo, 32 P. Dado que el fósforo se encuentra en el ADN, pero no en la proteína, el ADN y no la proteína se marcaría con fósforo radioactivo. Asimismo, el azufre está ausente en el ADN, pero está presente en varios aminoácidos como la metionina y la cisteína.

Se permitió que cada lote de fagos infectara las células por separado. Después de la infección, la suspensión bacteriana del fago se colocó en un mezclador, lo que provocó que la capa del fago se separara de la célula huésped. A continuación, se examinaron las células expuestas el tiempo suficiente para que ocurriera la infección para ver cuál de las dos moléculas radiactivas había entrado en la célula. La suspensión de fagos y bacterias se centrifugó en una centrífuga. Las células bacterianas más pesadas se asentaron y formaron un sedimento, mientras que las partículas de fagos más ligeros permanecieron en el sobrenadante. En el tubo que contenía el fago marcado con 35 S, el sobrenadante contenía el fago marcado radiactivamente, mientras que no se detectó radiactividad en el sedimento. En el tubo que contenía el fago marcado con 32 P, se detectó radiactividad en el sedimento que contenía las células bacterianas más pesadas y no se detectó radiactividad en el sobrenadante. Hershey y Chase concluyeron que fue el ADN del fago el que se inyectó
en la célula y transportaba información para producir más partículas de fagos, lo que proporciona evidencia de que el ADN era el material genético y no las proteínas ((Figura)).


Por esta misma época, el bioquímico austriaco Erwin Chargaff examinó el contenido de ADN en diferentes especies y descubrió que las cantidades de adenina, timina, guanina y citosina no se encontraban en cantidades iguales, y que las concentraciones relativas de las cuatro bases de nucleótidos variaban de una especie a otra. a especies, pero no dentro de tejidos del mismo individuo o entre individuos de la misma especie. También descubrió algo inesperado: que la cantidad de adenina era igual a la cantidad de timina y la cantidad de citosina era igual a la cantidad de guanina (es decir, A = T y G = C). Diferentes especies tenían cantidades iguales de purinas (A + G) y pirimidinas (T + C), pero diferentes proporciones de A + T a G + C. Estas observaciones se conocieron como reglas de Chargaff. Los hallazgos de Chargaff & # 8217 resultaron inmensamente útiles cuando Watson y Crick se estaban preparando para proponer su modelo de doble hélice de ADN. Después de leer las últimas páginas, puede ver cómo la ciencia se basa en descubrimientos anteriores, a veces en un proceso lento y laborioso.

Resumen de la sección

El ADN fue aislado por primera vez de los glóbulos blancos por Friedrich Miescher, quien lo llamó nucleína porque estaba aislado de los núcleos. Frederick Griffith & # 8217s experimentos con cepas de steotococos neumonia proporcionó el primer indicio de que el ADN puede ser el principio transformador. Avery, MacLeod y McCarty demostraron que el ADN es necesario para la transformación de bacterias. Experimentos posteriores de Hershey y Chase utilizando el bacteriófago T2 demostraron que el ADN es el material genético. Chargaff descubrió que la proporción de A = T y C = G, y que el contenido porcentual de A, T, G y C es diferente para diferentes especies.

Preguntas de revisión

Si se analizó el ADN de una especie en particular y se encontró que contiene 27 por ciento de A, ¿cuál sería el porcentaje de C?

Los experimentos de Hershey y Chase ayudaron a confirmar que el ADN era el material hereditario sobre la base del hallazgo de que:

  1. Se encontraron fagos radiactivos en el sedimento.
  2. Se encontraron células radiactivas en el sobrenadante.
  3. Se encontró azufre radiactivo dentro de la celda.
  4. Se encontró fósforo radiactivo en la célula.

La transformación bacteriana es una preocupación importante en muchos entornos médicos. ¿Por qué podrían preocuparse los proveedores de atención médica?

  1. Las bacterias patógenas podrían introducir genes causantes de enfermedades en bacterias no patógenas.
  2. Los genes de resistencia a los antibióticos podrían introducirse en nuevas bacterias para crear "superbacterias".
  3. Los bacteriófagos podrían propagar el ADN que codifica las toxinas a nuevas bacterias.
  4. Todo lo anterior.

Preguntas de pensamiento crítico

Explique los experimentos de transformación de Griffith & # 8217s. ¿Qué concluyó de ellos?

Las células R vivas adquirieron información genética de las células S muertas por calor que "transformaron" las células R en células S.

¿Por qué se utilizaron azufre y fósforo radiactivos para marcar bacteriófagos en los experimentos de Hershey y Chase & # 8217s?

El azufre es un elemento que se encuentra en las proteínas y el fósforo es un componente de los ácidos nucleicos.

Cuando Chargaff estaba realizando sus experimentos, la hipótesis del tetranucleótido, que afirmaba que el ADN estaba compuesto por repeticiones de nucleótidos GACT, era la visión más aceptada de la composición del ADN. ¿Cómo refutó Chargaff esta hipótesis?

Si la hipótesis del tetranucleótido fuera cierta, entonces el ADN tendría que contener cantidades iguales de los cuatro nucleótidos (A = T = G = C). Sin embargo, Chargaff demostró que A = T y G = C, pero que los cuatro nucleótidos no están presentes en cantidades iguales.


Martha Chase: Por los libros

El experimento Hershey-Chase es el estudio histórico que solidificó la función del ADN como portador de información genética sobre las proteínas.

Martha Chase

Martha Chase era una genetista estadounidense que formó parte del dúo con Alfred Hershey, que llevó a cabo el innovador trabajo. El trabajo le valió a Hershey el Premio Nobel de Fisiología o Medicina en 1969, compartido con Max Delbrück y Salvador Luria, por sus "descubrimientos sobre la estructura genética de los virus". La exclusión de Chase del premio sigue siendo un misterio. Algunos cuestionan las contribuciones intelectuales de Chase al trabajo, así como el hecho de que ella era asistente de investigación en el equipo y no investigadora principal. Sin embargo, su contribución es evidente dado que el histórico experimento Hershey-Chase incluye su nombre. Por lo tanto, se podría especular que el desaire al Premio Nobel puede tener que ver con las actitudes patriarcales en ese momento.

Chase nació en Cleveland, Ohio en 1927 y recibió una licenciatura del College of Wooster en 1950. Trabajó como asistente de investigación en Cold Spring Harbor Laboratory en el laboratorio del bacteriólogo y genetista Alfred Hershey antes de regresar a la escuela en 1959. obtuvo un doctorado en Microbiología de la Universidad del Sur de California en 1964.

En California, Chase conoció y se casó con su colega científico Richard Epstein a fines de la década de 1950 y cambió su nombre a Martha C. Epstein. El matrimonio terminó en divorcio después de unos pocos años. Después de eso, algunos reveses personales en la década de 1960 la llevaron a poner fin a su carrera científica. Regresó a Ohio para vivir con su familia y, en sus últimos años, desarrolló demencia que la llevó a la pérdida de la memoria a corto plazo. Murió de neumonía a la edad de 75 años el 8 de agosto de 2003.

Fue durante su tiempo en el laboratorio de Hershey en la década de 1950, antes del doctorado, cuando ella y Hershey realizaron el experimento Hershey-Chase, que ayudó a confirmar que el ADN es el portador y transmisor de información genética.

El experimento Hershey-Chase fue en realidad un conjunto de experimentos realizados por Hershey y Chase que les ayudó a concluir que el ADN servía como material genético de una célula. Si bien la estructura del ADN había sido aclarada unos pocos años antes por el grupo de Rosalind Franklin, James Watson, Francis Crick y Maurice Wilkins, su función seguía siendo en gran parte desconocida. Al mismo tiempo, se pensó que la proteína era la portadora de información genética, ya que el ADN era una sustancia demasiado inerte, y también estaba protegida en el núcleo, para poder albergar tal función.

En los experimentos, Hershey y Chase infectaron bacterias con bacteriófagos marcados radiactivamente (virus que infectan específicamente a las bacterias), que constan de ADN y proteínas. Los bacteriófagos inyectan su ADN en las células pero no en la proteína, que es principalmente un componente de su envoltura externa o cápside. A través de las etiquetas radiactivas, pudieron rastrear cuál de los dos, ADN o proteína, se inyectó en la bacteria.

Llevaron a cabo dos experimentos, uno con fósforo radiactivo para marcar el ADN y otro con azufre radiactivo para marcar la proteína (el ADN no contiene azufre y la proteína no contiene grupos fosfato). En cada uno de los experimentos, observaron si la señal radiactiva se encontraba en la célula o fuera de la célula.

El experimento también se conoce como el "experimento de la licuadora Waring", ya que se utilizó una licuadora de cocina Waring para separar las bacterias de los virus después de la infección. Después del desprendimiento, la mezcla se centrifugó, esto se hizo para destruir la integridad de la membrana externa de las células bacterianas y, por lo tanto, eliminar los fagos adheridos al exterior de las bacterias. Mientras tanto, cualquier material radiactivo que hubiera entrado en las células estaría intacto y sería detectable.

El experimento reveló que en la muestra de fósforo radiactivo, se eliminó el 40 por ciento de las partículas marcadas, mientras que en la muestra marcada con azufre se eliminó el 80 por ciento de las partículas marcadas. Dado que se eliminó más proteína de los fagos de las bacterias que el ADN, los resultados demostraron que el ADN podía ingresar fácilmente a las células y no a las proteínas. Y dado que el ADN llegó a las bacterias, fue el portador de información genética y jugó un papel en la reproducción.

A pesar de no ganar elogios formales por su trabajo, a saber, el Premio Nobel, el trabajo de Chase es ciertamente reconocido cada vez que un estudiante de biología molecular o genética toma un libro de texto y lee sobre el experimento fundamental de Hershey-Chase, que tiene su nombre estampado en él, bastante. literalmente.


Tamilnadu Samacheer Kalvi 12th Bio Zoology Solutions Capítulo 5 Genética molecular

Ya sea que desee convertirse en un experto en Bio Zoología o obtener buenas calificaciones en el examen, tiene una y única solución: practicar con Samacheer Kalvi 12th Bio Zoology Chapter Wise Solutions. Refuerce su debilidad aprendiendo las preguntas y respuestas de Samacheer Kalvi 12th Bio Zoology Chapter 5 Molecular Genetics en nuestro sitio. Puede aprender directamente en línea en nuestro sitio web o aprender fuera de línea descargando el material inteligente del Capítulo 12 de Bio Zoología de Samacheer Kalvi. Ahorre tiempo y lea Samacheer Kalvi 12th Bio Zoology Subject a su nivel de comodidad.

Samacheer Kalvi 12th Bio Zoology Molecular Genetics Text Book Volver Preguntas y respuestas

Pregunta 1.
El experimento de Hershey y Chase con bacteriófagos mostró que
(a) La proteína ingresa a las células bacterianas
(b) el ADN es el material genético
(c) el ADN contiene azufre radiactivo
(d) Los virus se transforman
Respuesta:
(b) el ADN es el material genético

Pregunta 2.
El ADN y el ARN son similares con respecto a
(a) Timina como base de nitrógeno
(b) Una forma de hélice monocatenaria
(c) Nucleótidos que contienen azúcares, bases nitrogenadas y fosfatos.
(d) La misma secuencia de nucleótidos para el aminoácido fenilalanina.
Respuesta:
(c) Nucleótidos que contienen azúcares, bases nitrogenadas y fosfatos.

Pregunta 3.
Una molécula de ARNm es producida por
(a) Replicación
(b) Transcripción
(c) Duplicación
(d) Traducción
Respuesta:
(b) Transcripción

Pregunta 4.
Se estima que el número total de bases nitrogenadas en el genoma humano es de aproximadamente
(a) 3,5 millones
(b) 35000
(c) 35 millones
(d) 3,1 mil millones
Respuesta:
(d) 3,1 mil millones

Pregunta 5.
Las células de E. coli cultivadas en medio 15N se transfieren a medio 14N y se dejan crecer durante dos generaciones. El ADN extraído de estas células se ultracentrifuga en un gradiente de densidad de cloruro de cesio. ¿Qué distribución de densidad de ADN esperarías en este experimento?
(a) Una banda de alta y una de baja densidad
(b) Una banda de densidad intermedia
(c) Una banda de densidad alta y otra intermedia
(d) Una banda de densidad baja y otra intermedia
Respuesta:
(d) Una banda de densidad baja y otra intermedia

Pregunta 6.
¿Cuál es la base de la diferencia en la síntesis de la cadena principal y rezagada de moléculas de ADN?
(a) El origen de la replicación ocurre solo en el extremo 5 'de las moléculas
(b) La ADN ligasa funciona solo en la dirección 3 '→ 5'
(c) La ADN polimerasa puede unir nuevos nucleótidos solo al extremo 3 'del rodal en crecimiento.
(d) Helicasas y proteínas de unión de una sola hebra que funcionan en el extremo 5 '
Respuesta:
(d) Helicasas y proteínas de unión de una sola hebra que funcionan en el extremo 5 '

Pregunta 7.
¿Cuál de las siguientes es la secuencia correcta de eventos con referencia al dogma central?
(a) Transcripción, traducción, replicación
(b) Transcripción, replicación, traducción
(c) Duplicación, traducción, transcripción
(d) Replicación, transcripción, traducción
Respuesta:
(d) Replicación, transcripción, traducción

Pregunta 8.
¿Cuál de las siguientes afirmaciones sobre la replicación del ADN no es correcta?
(a) El desenrollamiento de la molécula de ADN ocurre cuando se rompen los enlaces de hidrógeno.
(b) La replicación ocurre cuando cada base se empareja con otra exactamente igual
(c) El proceso se conoce como replicación semi & # 8211 conservadora porque una hebra antigua se conserva en la nueva molécula
(d) Los pares de bases complementarios se mantienen unidos con enlaces de hidrógeno.
Respuesta:
(b) La replicación ocurre cuando cada base se empareja con otra exactamente igual

Pregunta 9.
¿Cuál de las siguientes afirmaciones no es cierta sobre la replicación del ADN en eucariotas?
(a)) La replicación comienza en un solo origen de replicación.
(b) La replicación es bidireccional desde los orígenes.
(c) La replicación se produce a aproximadamente 1 millón de pares de bases por minuto.
(d) Existen numerosos cromosomas bacterianos diferentes, y la replicación ocurre en cada uno al mismo tiempo.
Respuesta:
(d) Existen numerosos cromosomas bacterianos diferentes, y la replicación ocurre en cada uno al mismo tiempo.

Pregunta 10.
El primer codón que se descifró fue qué códigos para
(a) AAA, prolina
(b) GGG, alanina
(c) UUU, fenilalanina
(d) TTT, arginina
Respuesta:
(c) UUU, fenilalanina

Pregunta 11.
El experimento de Meselson y Stahl demostró __________
(a) Transducción
(b) Transformación
(c) el ADN es el material genético
(d) Naturaleza semiconservadora de la replicación del ADN
Respuesta:
(d) Naturaleza semiconservadora de la replicación del ADN

Pregunta 12.
Los ribosomas se componen de dos subunidades, la subunidad más pequeña de un ribosoma tiene un sitio de unión y la subunidad más grande tiene dos sitios de unión para dos
Respuesta:
ARNm, ARNt

Pregunta 13.
Anoperonisa:
(a) Proteína que suprime la expresión génica
(b) Proteína que acelera la expresión génica
(c) Grupo de genes estructurales con función relacionada
(d) Gen que activó o desactivó otros genes
Respuesta:
(d) Gen que activó o desactivó otros genes

Pregunta 14.
Cuando la lactosa está presente en el medio de cultivo:
(a) Se produce la transcripción de los genes lacy, lac z, lac a
(b) El represor no puede unirse al operador
(c) El represor puede unirse al operador
(d) Ambos (a) y (b) son correctos
Respuesta:
(d) Ambos (a) y (b) son correctos

Pregunta 15.
Da razones: el código genético es "universal".
Respuesta:
El código genético es universal. Significa que todos los sistemas vivos conocidos usan ácidos nucleicos y los mismos codones de tres bases (codón triplete) dirigen la síntesis de proteínas a partir de aminoácidos. Por ejemplo, el codón del ARNm (UUU) codifica la fenilalanina en todas las células de todos los organismos. Se informan algunas excepciones en genomas procarióticos, mitocondriales y de cloroplasto. Sin embargo, las similitudes son más comunes que las diferencias.

Pregunta 16.
Nombra las partes marcadas con "A" y "B" en la unidad de transcripción dada:
Respuesta:

Pregunta 17.
Diferenciar & # 8211 Hebra principal y hebra rezagada
Respuesta:

  1. ADN polimerasa I Mecanismo de reparación del ADN involucrado
  2. ADN polimerasa II Mecanismo de reparación del ADN involucrado
  3. ADN polimerasa III involucrada en la replicación del ADN

Pregunta 18.
Diferenciar & # 8211 hebra de plantilla y hebra de codificación.
Respuesta:

  1. Cadena de plantilla: durante la replicación, la cadena de ADN que tiene la polaridad 3 '→ 5' actúa como cadena de plantilla.
  2. Cadena de codificación: durante la replicación, la cadena de ADN que tiene la polaridad 5 '→ 3' actúa como cadena de codificación.

Pregunta 19.
Mencione dos formas en las que el polimorfismo de un solo nucleótido (SNP) identificado en el genoma humano puede traer un cambio revolucionario en la ciencia biológica y médica.
Respuesta:
Los científicos han identificado alrededor de 1,4 millones de ubicaciones, donde las diferencias de ADN de una sola base (SNP & # 8211 Polimorfismo de nucleótido único & # 8211 pronunciado como "snips") ocurren en humanos. La identificación de "SNIPS" es útil para encontrar ubicaciones cromosómicas para secuencias asociadas a enfermedades y rastrear la historia humana.

Pregunta 20.
Enuncie tres objetivos del proyecto del genoma humano.
Respuesta:

  1. Identifique todos los genes (aproximadamente 30000) en el ADN humano.
  2. Determine la secuencia de los tres mil millones de pares de bases químicas que componen el ADN humano.
  3. Almacenar esta información en bases de datos.

Pregunta 21.
En E. coli, se producen tres enzimas O-galactosidasa, permeasa y transacetilasa en presencia de lactosa. Explique por qué las enzimas no se sintetizan en ausencia de lactosa.
Respuesta:
En ausencia de lactosa, la proteína represora se une al operador e impide la transcripción del gen estructural por la ARN polimerasa, por lo que no se producen las enzimas. Sin embargo, siempre habrá un nivel mínimo de expresión del operón lac incluso en ausencia de lactosa.

Pregunta 22.
Distinguir entre gen estructural, gen regulador y gen operador.
Respuesta:
Estructura del operón: cada operón es una unidad de expresión y regulación génica y consta de uno o más genes estructurales y un gen operador adyacente que controla la actividad transcripcional del gen estructural.

  1. El gen estructural codifica proteínas, rRNA y tRNA requeridos por la célula.
  2. Los promotores son las secuencias señal en el ADN que inician la síntesis de ARN. La ARN polimerasa se une al promotor antes del inicio de la transcripción.
  3. Los operadores están presentes entre los promotores y los genes estructurales. La proteína represora se une a la región operadora del operón.

Pregunta 23.
Un bajo nivel de expresión del operón lac ocurre todo el tiempo en E-coli. Justifica la afirmación.
Respuesta:
Una de las enzimas sintetizadas por el operón lac es la permeasa, que participa en el transporte de lactosa al interior de las células. Si el operón lac se inactiva, la permeasa no se sintetiza, por lo que la lactosa no puede ingresar a la célula. La lactosa actúa como inductor, se une a la proteína represora y activa al operador para iniciar la expresión génica.

Pregunta 24.
¿Por qué el proyecto del genoma humano se llama megaproyecto?
Respuesta:
El proyecto internacional del genoma humano se lanzó en el año 1990. Fue un megaproyecto y tardó 13 años en completarse. El genoma humano es aproximadamente 25 veces más grande que el genoma de cualquier organismo secuenciado hasta la fecha y es el primer genoma de vertebrado en completarse. Se dice que el genoma humano tiene aproximadamente 3 & gt109 pb. HGP estuvo estrechamente asociado con el rápido desarrollo de una nueva área en biología llamada bioinformática.

Pregunta 25.
A partir de su examen de la estructura del ADN, ¿qué dedujeron Watson y Crick sobre el probable mecanismo de replicación, capacidad de codificación y mutación del ADN?
Respuesta:
Inferencia de Watson y Crick sobre la replicación del ADN: Llegaron a la conclusión de que cada una de las cadenas de ADN en una hélice actúa como plantilla durante la replicación del ADN, lo que lleva a la formación de nuevas moléculas de ADN hijas, que son complementarias a la cadena parental (es decir, método semiconservador de replicación) Inferencia sobre la capacidad de codificación: Durante la transcripción, la información genética en la hebra de ADN se codifica en ARNm como bases complementarias (excepto para uracilo en lugar de timina en el ARN) Inferencia sobre mutación: Cualquier cambio en la secuencia de nucleótidos del ADN conduce a alteración correspondiente en la secuencia de aminoácidos de una proteína específica, lo que confirma la validez del código genético.

Pregunta 26.
¿Por qué el ARNt se llama molécula adaptadora?
Respuesta:
La molécula de ARN de transferencia (ARNt) de una célula actúa como un vehículo que recoge los aminoácidos esparcidos por el citoplasma y también lee códigos específicos de moléculas de ARNm. Por eso se le llama molécula adaptadora. Este término fue postulado por Francis Crick.

Pregunta 27.
¿Cuáles son las tres diferencias estructurales entre el ARN y el ADN?
Respuesta:
ADN:

  1. El azúcar es azúcar desoxirribosa.
  2. Estructura bicatenaria.
  3. Las bases nitrogenadas son adenina, guanina, citosina y timina.
  1. El azúcar es azúcar ribosa.
  2. Molécula monocatenaria.
  3. Las bases nitrogenadas son adenina, guanina, citosina y uracilo.

Pregunta 28.
Nombre el anticodón necesario para reconocer los siguientes codones:
AAU, CGA, UAU y GCA.
Respuesta:
UUA, GCU, AUA y CGU.

Pregunta 29.
(a) Identifique la figura que se da a continuación
(b) Vuelva a dibujar la estructura como una bifurcación de replicación y etiquete las partes
(c) Escriba la fuente de energía para esta replicación y nombre la enzima involucrada en este proceso.
(d) Mencione las diferencias en la síntesis de proteínas, basadas en la polaridad de las dos cadenas molde.
Respuesta:
(a) Bifurcación de replicación
(B)

(c) Deoxi nucleótido, el trifosfato actúa como fuente de energía para la replicación. La ADN polimerasa se utiliza para la replicación.
(d) La información de contacto del ARNm para la síntesis de proteínas se desarrollará a partir de una cadena de ADN con polaridad 5 '→ 3'

Pregunta 30.
Si la secuencia de codificación en una unidad de transcripción se escribe de la siguiente manera:
5 ’TGCATGCATGCATGCATGCATGCATGC 3’
Anote la secuencia de ARNm.
Respuesta:
La secuencia de ARNm es 3’ACGUACGUACGUUCGUACGUACGUACG5 ’

Pregunta 31.
¿Qué ventajas tiene el proceso de síntesis de proteínas en dos etapas?
Respuesta:
La característica del gen dividido de los genes eucariotas está casi completamente ausente en los procariotas. Originalmente, cada exón puede haber codificado una única cadena polipeptídica con una función específica. Dado que la disposición de los exones y la eliminación de los intrones son flexibles, el exón que codifica estas subunidades polipeptídicas actúa como dominios que se combinan de diversas formas para formar nuevos genes. Los genes individuales pueden producir diferentes proteínas funcionales ordenando sus exones de varias formas diferentes a través de patrones de empalme alternativos, un mecanismo conocido por desempeñar un papel importante en la generación de diversidad funcional y de proteínas en los animales. Los intrones habrían surgido antes o después de la evolución del gen eucariota.

Si los intrones surgieron tarde, ¿cómo entraron en el gen eucariota? Los intrones son secuencias de ADN móviles que pueden empalmarse de, así como en, "sitios objetivo" específicos que actúan como elementos móviles similares a transposones (que median la transferencia de genes entre organismos & # 8211 Horizontal Gene Transfer & # 8211 HGT). La HGT ocurre entre linajes de células procariotas, o de células procariotas a eucariotas y entre células eucariotas. Ahora se plantea la hipótesis de que la HGT jugó un papel importante en la evolución de la vida en la Tierra.

Pregunta 32.
¿Por qué Hershey y Chase utilizaron únicamente fósforo y azufre marcados radiactivamente? ¿Habrían obtenido el mismo resultado si usaran carbono y nitrógeno radiomarcados?
Respuesta:
Generalmente las proteínas contienen azufre pero no fósforo y el ácido nucleico (ADN) contiene fósforo pero no azufre. Por lo tanto, Hershey & # 8211 Chase utilizó isótopos radiactivos de azufre (3 5 S) y fósforo (32 P) para realizar un seguimiento separado de la proteína viral y el ácido nucleico en el medio de cultivo. No se puede lograr el resultado esperado si se usa carbono y nitrógeno radiactivos, ya que estas moléculas están presentes tanto en el ADN como en las proteínas.

Pregunta 33.
Explica la formación de un nucleosoma.
Respuesta:
Komberg propuso un modelo para el nucleosoma, en el que 2 moléculas de las cuatro proteínas histonas H2A, H2B, H3 y H4 se organizan para formar una unidad de ocho moléculas llamada histona octamere.

El ADN cargado negativamente se envuelve alrededor del octamero de histonas cargadas positivamente para formar una estructura llamada nucleosoma. Un nucleosoma típico contiene 200 pb de hélice de ADN. Los octameros de histonas están en estrecho contacto y el ADN está enrollado en el exterior del nucleosoma.

Pregunta 34.
Está establecido que el ARN es el primer material genético. Justifica dando razones.
Respuesta:
Tres biólogos moleculares a principios de la década de 1980 (Leslie Orgel, Francis Brick y Carl Woese) propusieron de forma independiente el "mundo del ARN" como la primera etapa en la evolución de la vida, una etapa en la que el ARN catalizaba todas las moléculas necesarias para la supervivencia y la replicación. El término "mundo de ARN", utilizado por primera vez por Walter Gilbert en 1986, plantea la hipótesis de que el ARN es la primera genética de la Tierra. Ahora hay suficiente evidencia para sugerir que los procesos vitales esenciales (como el metabolismo, la traducción y el empalme, etc.) evolucionaron alrededor del ARN. El ARN tiene la capacidad de actuar como material genético y catalizador. Hay varias reacciones bioquímicas en los sistemas vivos que son catalizadas por ARN. Este ARN catalítico se conoce como ribozima. Pero, el ARN como catalizador era reactivo y, por lo tanto, inestable.

Esto condujo a la evolución de una forma de ADN más estable, con ciertas modificaciones químicas. Dado que el ADN es una molécula de doble hebra que tiene una hebra complementaria, ha resistido los cambios al desarrollar un proceso de reparación. Algunas moléculas de ARN funcionan como reguladores de genes al unirse al ADN y afectar la expresión de genes. Algunos virus usan ARN como material genético. Andrew Fire y Craig Mellow (ganadores del Premio Nobel en 2006) opinaron que el ARN es un ingrediente activo en la química de la vida.

Samacheer Kalvi 12th Bio Zoology Molecular Genetics Preguntas y respuestas adicionales

Pregunta 1.
El término "gen" fue acuñado por ___________
Respuesta:
Wilhelm Johannsen

Pregunta 2.
¿El experimento de quién finalmente proporcionó evidencia convincente de que el ADN es el material genético?
(a) Experimento de Griffith
(b) El experimento de Avery, Macleod y McCarty
(c) Experimento de Hershey-Chase
(d) Experimento de Urey-Miller
Respuesta:
(c) Experimento de Hershey-Chase

Pregunta 3.
En el experimento de Hershey & # 8211 Chase, el ADN de la fase T 2 se hizo radioactivo usando ___________
(a) 32 P
(b) 32 S
(c) 35 P
(d) 32 S
Respuesta:
(a) 32 P

Pregunta 4.
Un nucleósido se compone de ___________
(a) Azúcar y fosfato
(b) Base de nitrógeno y fosfato
(c) Base de azúcar y nitrógeno
(d) Azúcar, fosfato y base nitrogenada
Respuesta:
(c) Base de azúcar y nitrógeno

Pregunta 5.
Identificar la declaración incorrecta
(a) una base es una sustancia que acepta iones H +
(b) Tanto el ADN como el ARN tienen cuatro bases
(c) Las purinas tienen un solo anillo carbono-nitrógeno
(d) La timina es única para el ADN
Respuesta:
(c) Las purinas tienen un solo anillo carbono-nitrógeno

Pregunta 6.
Watson y Crick propusieron su modelo de ADN de doble hélice basado en el análisis de difracción de rayos X de ___________
a) Erwin Chargaff
(b) Meselson y Stahl
(c) Wilkins y Franklin
(d) Griffith
Respuesta:
(c) Wilkins y Franklin

Pregunta 7.
El término "mundo de ARN" fue utilizado por primera vez por ___________
Respuesta:
Walter Gilbert

Pregunta 8.
La distancia entre dos pares de bases consecutivos en el ADN es ___________
(a) 0,34 nm
(b) 3,4 nm
(c) 0,034 nm
(d) 34 millas náuticas
Respuesta:
(a) 0,34 nm

Pregunta 9.
Si la longitud del ADN de E. coli es 1,36 mm, el número de pares de bases es ___________
(a) 0,36 × 10 6 m
(b) 4 × 10 6 m
(c) 0,34 × 10 -9 nm
(d) 4 × 10 -9 m
Respuesta:
(b) 4 × 10 6 m

Pregunta 10.
Identificar la secuencia adecuada en la organización del cromosoma eucariota.
(a) Nucleosoma & # 8211 Solenoide & # 8211 Cromatid
(b) Cromátida y nucleosoma # 8211 y solenoide # 8211
(c) Solenoide y cromatina # 8211 y ADN # 8211
(d) Nucleosoma & # 8211 solenoide & # 8211 genophore
Respuesta:
(a) Nucleosoma & # 8211 Solenoide & # 8211 Cromatid

Pregunta 11.
Afirmación (A): el genóforo se nota en los procariotas.
Razón (R): Las bacterias poseen ADN circular sin organización de cromatina.
(a) Tanto A como R son correctos
(b) A es correcto R es incorrecto
(c) R explica A
(d) A es incorrecto R es correcto
Respuesta:
(c) R explica A

Pregunta 12.
Afirmación (A): La heterocromatina es transcripcionalmente activa.
Razón (R): cromatina compacta que se tiñe de oscuro.
(a) Tanto A como R son correctos
(b) A es correcto R es incorrecto
(c) R explica A
(d) A es incorrecto R es correcto
Respuesta:
(d) A es incorrecto R es correcto

Pregunta 13.
Afirmación (A): Hershey y Chase propusieron un modelo semiconservador.
Razón (R): El ADN hijo contiene solo hebras nuevas.
(a) Tanto A como R son incorrectos
(b) A es correcto R es incorrecto
(c) R explica A
(d) A es incorrecto R es correcto
Respuesta:
(a) Tanto A como R son incorrectos

Pregunta 14.
La enzima de Komberg se llama _____
Respuesta:
ADN polimerasa I

Pregunta 15.
La replicación del ADN ocurre en la fase __________ del ciclo celular.
(soy
(b) S
(c) G1
(d) G2
Respuesta:
(b) S

Pregunta 16.
El modelo semiconservador de replicación fue probado por __________
(a) Hershey y Chase
(b) Griffith
(c) Meselson y Stahl
(d) Macleod y McCarty
Respuesta:
(c) Meselson y Stahl

Pregunta 17.
¿Cuántos tipos de ADN polimerasas posee una célula eucariota?
(un dos
(b) tres
(c) cuatro
(d) cinco
Respuesta:
(d) Cinco

Pregunta 18.
Identificar la declaración incorrecta
(a) La replicación ocurre en el sitio ori & # 8211 del ADN
(b) El trifosfato de desoxi nucleótido actúa como sustrato
(c) El desenrollamiento de la cadena de ADN se lleva a cabo mediante topoisomerasa.
(d) La ADN polimerasa cataliza la polimerización en 3-OH
Respuesta:
(c) El desenrollamiento de la cadena de ADN se lleva a cabo mediante topoisomerasa.

Pregunta 19.
Los fragmentos de hebra rezagada sintetizados de forma discontinua se denominan ________
Respuesta:
Fragmentos de Okazaki

Pregunta 20.
Los retrovirus poseen ________ como material genético.
Respuesta:
ARN

Pregunta 21.
¿Qué NO forma parte de la unidad de transcripción?
(a) Promotor
(b) Operador
(c) Gen estructural
(d) Terminador
Respuesta:
(b) Operador

Pregunta 22.
Goldberg & # 8211 Hogness caja de eucariotas es equivalente a ________ de procariotas.
Respuesta:
Caja Pribnow

Pregunta 23.
Los fragmentos de Okazaki son unidos por la enzima ________ durante la replicación del ADN.
Respuesta:
ADN ligasa

Pregunta 24.

Respuesta:
(a) A & # 8211 iv, B & # 8211 i, C & # 8211 ii, D & # 8211 iii

Pregunta 25.
La ARN polimerasa de los procariotas se une al factor para iniciar la polimerización.
(a) rho
(b) theta
(c) sigma
(d) psi
Respuesta:
(c) sigma

Pregunta 26.

(a) Tapado
(b) Colas
(c) Empalme
(d) Transcripción
Respuesta:
(c) Empalme

Pregunta 27.
¿Cuál de las siguientes características está ausente en los procariotas?
(a) Los procariotas poseen tres tipos principales de ARN
(b) Los genes estructurales son policistrónicos
(c) El proceso de inicio de la transcripción requiere el factor "P"
(d) Característica del gen dividido
Respuesta:
(d) Característica del gen dividido

Pregunta 28.
¿Cuál de las siguientes secuencias se ha traducido por completo?
(i) AGA, UUU, UGU, AGU, UAG
(ii) AUG, UUU, AGA, UAC, UAA
(iii) AAA, UUU, UUG, UGU, UGA
(iv) AUG, AAU, AAC, UAU, UAG
(a) iy ii
(b) ii solamente
(c) i y iii
(d) ii y iv
Respuesta:
(d) ii y iv

Pregunta 29.
El taponamiento del ARNm se produce mediante __________
(a) Residuos de poli A
(b) Trifosfato de metil guanosina
(c) Trifosfato de desoxi ribonucleótido
(d) Trifosfato de ribonucleótido
Respuesta:
(b) Trifosfato de metil guanosina

Pregunta 30.
¿Uno de los aspectos no es una característica del código genético?
(especifico
(b) Degenerado
(c) Universal
(d) ambiguo
Respuesta:
(d) ambiguo

Pregunta 31.
¿Cuál de los codones del triplete no es un código de prolina?
(i) CCU
(ii) CAU
(iii) CCG
(iv) CAA
(a) yo solo
(b) ii y iv
(c) iii solamente
(d) todo lo anterior
Respuesta:
(b) ii y iv

Pregunta 32.
Las secuencias codificantes que se encuentran en genes divididos se denominan.
(a) Operones
(b) Intrones
(c) Exones
(d) Cistron
Respuesta:
(c) Exones

Pregunta 33.
¿Cuál de los siguientes ARNm produce 6 aminoácidos después de la traducción?
(i) UCU UAU AGU CGA UGC AGU UGA AAA UUU
(ii) UGA AGA UAG GAG CAU CCC UAC UAU GAU
(iii) GUC UGC UGG GCU GAU UAA AGG AGC AUU
(iv) AGO UAC CAU UGC UGA UGC AGG AGC CCG
Respuesta:
(i) UCU UAU AGU CGA UGC AGU UGA AAA UUU

Pregunta 34.
El factor de terminación de la transcripción asociado con la ARN polimerasa en procariotas es
(a) θ
(b) σ
(c) ρ
(d) ∑
Respuesta:
(c) ρ

Pregunta 35.
En una doble hebra de ADN, si la guanina es del 30%, ¿cuál será el porcentaje de timina?
(a) 100%
(b) 20%
(c) 10%
(d) 70%
Respuesta:
(b) 20%

Pregunta 36.
Identificar los pares de tripletes que codifican la tirosina.
(a) UUU, UUC
(b) UAU, UAU
(c) UGC, UGU
(d) CAU, CAC
Respuesta:
(b) UAU, UAU

Pregunta 37.

Respuesta:
A & # 8211 ii B & # 8211 i C & # 8211 iv D & # 8211 iii

Pregunta 38.
El código AUG es para __________
(a) Arginina
(b) Tirosina
(c) Triptófano
(d) Metionina
Respuesta:
(d) Metionina

Pregunta 39.
La secuencia de bases en la cadena codificante de ADN es G A G T T A G C A G G C, entonces la secuencia de codones en la transcripción primaria es
(a) C U C A U A C G C C C G
(b) C U C A A U C G U C C G
(c) U C A G A U C U G C G C
(d) U U C A A U C G U G C G
Respuesta:
(b) C U C A A U C G U C C G

Pregunta 40.
La región promotora de eucariota es __________
(a) TATAA
(b) AGOSTO
(c) UUUGA
(d) AAAAU
Respuesta:
(a) TATAA

Pregunta 41.
Une el siguiente:
(A) AUG y # 8211 (i) Tirosina
(B) UGA y # 8211 (ii) Glicina
(C) UUU y # 8211 (iii) Metionina
(D) GGG y # 8211 (iv) Fenilalanina
(a) A & # 8211 iii B & # 8211 i C & # 8211 iv D & # 8211 ii
(b) A & # 8211 iii B & # 8211 ii C & # 8211 i D & # 8211 iv
(c) A & # 8211 iv B & # 8211 i C & # 8211 iii D & # 8211 ii
(d) A & # 8211 ii B & # 8211 i C & # 8211 iv D & # 8211 iii
Respuesta:
(d) A & # 8211 ii B & # 8211 i C & # 8211 iv D & # 8211 iii

Pregunta 42.
__________ número de codones, códigos de cistina.
Respuesta:
Dos

Pregunta 43.
En la anemia de células falciformes, se modifica el codón __________ del gen de la globina β & # 8211.
(a) Octavo
(b) Séptimo
(c) Sexta
(d) Noveno
Respuesta:
(c) Sexta

Pregunta 44.
Elija la declaración incorrecta.
(a) El ARNt actúa como una molécula adaptadora
(b) Los codones de parada no tienen ARNt
(c) La adición de aminoácidos conduce a la hidrólisis del ARNt.
(d) ARNt tiene cuatro bucles principales
Respuesta:
(c) La adición de aminoácidos conduce a la hidrólisis del ARNt.

Pregunta 45.
¿Cuál de los siguientes antibióticos inhibe la interacción entre el ARNt y el ARNm?
(a) Neomicina
(b) Estreptomicina
(c) tetraciclina
(d) Cloranfenicol
Respuesta:
(a) Neomicina

Pregunta 47.
El grupo de genes con función relacionada se llama _________
(a) Cistron
(b) Operón
(c) Mutón
(d) Reconocimiento
Respuesta:
(b) Operón

Pregunta 48.
La proteína represora del operón Lac se une a __________ del operón.
(a) Región promotora
(b) Región del operador
(c) región del terminador
(d) región inductora
Respuesta:
(b) Región del operador

Pregunta 49.
Códigos del gen Lac Z para __________
(a) Permease
(b) transacetilasa
(c) β-galactosidasa
(d) Aminoacil transferasa
Respuesta:
(c) β-galactosidasa

Pregunta 50.
El modelo del operón lac fue propuesto por __________
Respuesta:
Jacob y Monod

Pregunta 51.
El recuento aproximado de pares de bases en el genoma humano es __________
Respuesta:
3 × 10 9 pb

Pregunta 52.
Las secuencias de ADN automatizadas son desarrolladas por.
Respuesta:
Frederick Sanger

Pregunta 53.
¿Cuál de los cromosomas tiene mayor densidad genética?
(a) Cromosoma 20
(b) Cromosoma 19
(c) Cromosoma 13
(d) Cromosoma Y
Respuesta:
(b) Cromosoma 19

Pregunta 54.
La cantidad de genes ubicados en el cromosoma Y es __________
(a) 2968
(b) 213
(c) 2869
(d) 231
Respuesta:
(d) 231

Pregunta 55.
¿Cuántos genes estructurales se encuentran en el operón lac de E. Coli?
(a) 4
(b) 3
(c) 2
(d) 1
Respuesta:
(b) 3

Pregunta 56.
La técnica de impresión digital de ADN fue desarrollada por
(a) Jacob y Monod
(b) Alec Jeffreys
(c) Frederick Sanger
Respuesta:
(b) Alec Jeffreys

Pregunta 57.
En la toma de huellas dactilares de ADN, la separación de los fragmentos de ADN se realiza mediante __________
(a) Centrifugación
(b) Electroforesis
(c) difracción de rayos X
(d) desnaturalización
Respuesta:
(b) Electroforesis

Pregunta 58.
SNP significa
(a) Polimorfismo de un solo nucleótido
(b) Polipéptido de un solo nucleósido
(c) Polimorfismo de un solo nucleótido
(d) Polímero de un solo nucleótido
Respuesta:
(a) Polimorfismo de un solo nucleótido

Pregunta 59.
Las secuencias específicas de ARNm que no se traducen son __________
Respuesta:
Regiones sin traducir (UTR)

Pregunta 60.
La secuencia de ADN no codificante o interviniente se llama __________

Pregunta 61.
_______ Intron es el monómero del ADN.
Respuesta:
Nucleótido

Pregunta 62.
¿Cuál de las siguientes coincidencias no coincide?
(a) Transcripción & # 8211 Copia de información de ADN a ARN
(b) Traducción & # 8211 Decodificación de información de ARNm a proteína
(c) Replicación y # 8211 Realización de copias de ADN
(d) Empalme y # 8211 Unión de exones con intrones
Respuesta:
(d) Empalme y # 8211 Unión de exones con intrones

Pregunta 1.
¿Quién propuso la hipótesis de Un gen & # 8211 Una enzima? Defínalo.
Respuesta:
George Beadle y Edward Tatum propusieron la hipótesis de Un gen & # 8211 Una enzima que establece que un gen controla la producción de una enzima.

Pregunta 2.
Diferenciar nucleósido de nucleótido.
Respuesta:

  1. Nucleósido: la subunidad de nucleósido está compuesta de bases nitrogenadas unidas a una molécula de azúcar pentosa.
  2. Nucleótido: la subunidad de nucleótidos está compuesta por bases nitrogenadas, un azúcar pentosa y un grupo fosfato.

Pregunta 3.
Indique las diferencias clave entre el ADN y el ARN.
Respuesta:
ADN:

  1. El ADN está hecho de azúcar desoxirribosa.
  2. Las bases nitrogenadas del ADN son adenina, guanina, citosina y timina.
  1. El ARN está hecho de azúcar ribosa.
  2. Las bases nitrogenadas del ARN son adenina, guanina, citosina y uracilo.

Pregunta 4.
Señale las bases nitrogenadas del ARN.
Respuesta:
Adenina, Guanina, Citosina y Uracilo.

Pregunta 5.
¿Qué hace que el ADN y el ARN sean moléculas ácidas?
Respuesta:
El grupo funcional fosfato (PO4) le da al ADN y al ARN la propiedad de un ácido a pH fisiológico, de ahí el nombre de ácido nucleico.

Pregunta 6.
Qué tipo de vínculo se forma

  1. entre una base de purina y pirimidina?
  2. entre el azúcar pentosa y el nucleótido adyacente?
  1. Las bases de purina y pirimidina están unidas por enlaces de hidrógeno.
  2. El azúcar pentosa está unido al nucleótido adyacente por enlaces fosfodiéster.

Pregunta 7.
El ADN actúa como material genético para la mayoría de los organismos vivos y no el ARN. Da razones para apoyar la afirmación.
Respuesta:

  1. El ARN era reactivo y, por tanto, muy inestable.
  2. Algunas moléculas de ARN actúan como reguladores de genes al unirse al ADN y afectar la expresión de genes.
  3. El uracilo de ARN es menos estable que la timina de ADN.

Pregunta 8.
Nombra dos virus cuyo material genético sea ARN.
Respuesta:

Pregunta 9.
¿Cuáles son las propiedades que debe poseer una molécula para actuar como material genético?
Respuesta:

  1. Autorreplicación
  2. Almacenamiento de informacion
  3. Estabilidad
  4. Variación por mutación

Pregunta 10.
¿Cuántos pares de bases están presentes en una vuelta completa de la hélice de ADN? ¿Cuál es la distancia entre dos pares de bases consecutivos?
Respuesta:
Hay diez pares de bases en cada turno con una distancia de 0,34 x 109 m entre dos pares de bases adyacentes.

Pregunta 11.
¿Qué es un genóforo?
Respuesta:
En procariotas como E. coli, aunque no tienen un núcleo definido, el ADN no está esparcido por toda la célula. El ADN (que tiene carga negativa) se mantiene con algunas proteínas (que tienen cargas positivas) en una región llamada nucleoide. El ADN como nucleoide está organizado en grandes bucles sostenidos por proteínas. El ADN de los procariotas es casi circular y carece de organización de cromatina, por lo que se denomina genóforo.

Pregunta 12.
¿Qué es el nucleosoma? ¿Cuántos pares de bases hay en un nucleosoma típico?
Respuesta:
El ADN cargado negativamente se envuelve alrededor del octamero de histonas cargadas positivamente para formar una estructura llamada nucleosoma. Un nucleosoma típico contiene 200 pb de hélice de ADN.

Pregunta 13.
Expandir y definir NHC
Respuesta:

  1. NHC: proteína cromosómica no histona.
  2. En eucariotas, además de las proteínas histonas, se requiere un conjunto adicional de proteínas para el empaquetamiento de la cromatina a un nivel superior y se denominan proteínas cromosómicas no histonas.

Pregunta 14.
Diferenciar entre heterocromatina y eucromatina.
Respuesta:
Heterocromatina:

  1. La región del núcleo donde la cromatina está suelta y las manchas claras se denominan heterocromatina.
  2. Transcripcionalmente inactivo.
  1. La región del núcleo donde la cromatina está compacta y las manchas oscuras se denominan eucromatina.
  2. Transcripcionalmente activo.

Pregunta 15.
¿Cuál es el modelo de replicación del ADN ampliamente aceptado? ¿Quién lo ha probado?
Respuesta:
Modelo de replicación semiconservador. Meselson y Stahl lo probaron en 1958.

Pregunta 16.
Nombra la sustancia química que recibe el nombre

  1. La ADN polimerasa I también se conoce como enzima de Komberg.
  2. La polinucleótido fosforilasa también se conoce como enzima de Ochoa.

Pregunta 17.
Nombra los distintos tipos de ADN polimerasa procariota. Indique su papel en el proceso de replicación.
Respuesta:

  1. ADN polimerasa I Involucionario en el mecanismo de reparación del ADN
  2. Involucionario de la ADN polimerasa II en el mecanismo de reparación del ADN
  3. Involver de la ADN polimerasa III en la replicación del ADN

Pregunta 18.
¿Cuál es la función del desoxi nucleótido trifosfato en la replicación?
Respuesta:
El desoxi nucleótido trifosfato actúa como sustrato y también proporciona energía para la reacción de polimerización.

Pregunta 19.
A continuación se presentan algunos eventos de replicación eucariota. Nombra las enzimas involucradas en el proceso.

  1. Desbobinado de ADN
  2. Unión de fragmentos de Okazaki
  3. Adición de nucleótidos a una nueva hebra.
  4. Corrigiendo la reparación

Pregunta 20.
Diferenciar la hebra principal de la hebra retrasada
Respuesta:
Filamento principal:

Pregunta 21.
¿Qué son los fragmentos de Okazaki?
Respuesta:
Los fragmentos sintetizados de forma discontinua de la hebra rezagada se denominan fragmentos de Okazaki que se unen mediante la enzima ADN ligasa.

Pregunta 22.
¿Qué es una bifurcación de replicación?
Respuesta:
En el punto de origen de la replicación, las helicasas y topoisomerasas (ADN girasa) desenrollan y separan las hebras, formando una estructura en forma de Y llamada horquilla de replicación. Hay dos bifurcaciones de replicación en cada origen.

Pregunta 23.
Aparte de la ADN polimerasa, nombre las otras cuatro enzimas que participaron en la replicación del ADN de la célula eucariota.
Respuesta:
ADN ligasa, topoisomerasa (ADN girasa), helicasa y nucleasa.

Pregunta 24.
¿Quién propuso el dogma central? Escribe su concepto.
Respuesta:
Francis Crick propuso el dogma central en biología molecular que establece que la información genética fluye de la siguiente manera:

Pregunta 25.
Defina la transcripción y nombre la enzima involucrada en este proceso.
Respuesta:
El proceso de copiar información genética de una hebra de ADN en ARN se denomina transcripción. Este proceso tiene lugar en presencia de ARN polimerasa dependiente de ADN.

Pregunta 26.
¿Qué es la caja TATA? Indique su función.
Respuesta:
En eucariotas, el promotor tiene regiones ricas en AT llamadas caja TATA o caja Goldberg-Hogness. Actúa como un sitio de unión para la ARN polimerasa.

Pregunta 27.
El gen estructural de los eucariotas se diferencia de los procariotas. ¿Cómo?
Respuesta:
En eucariotas, el gen estructural es monocistrónico que codifica solo una proteína, mientras que en los procariotas, el gen estructural es policistrónico que codifica muchas proteínas.

Pregunta 28.
¿Cuáles son los dos componentes principales de la ARN polimerasa procariota? ¿Cómo actúan?
Respuesta:
La ARN polimerasa bacteriana (procariota) consta de dos componentes principales, la enzima central y la subunidad sigma. La enzima central (β1, β y α) es responsable de la síntesis de ARN & # 8221, mientras que una subunidad sigma es responsable del reconocimiento del promotor.

Pregunta 29.
Distinguir entre exones e intrones.
Respuesta:

  1. Exones: secuencias expresadas (secuencias codificantes) de un gen eucariota
  2. Intrones: secuencias intervinientes (secuencias no codificantes) de un gen eucariota

Pregunta 30.
Definir empalme.
Respuesta:
El proceso de eliminación de intrones del hnRNA se llama empalme.

Pregunta 31.
¿Qué es tapping y tailing?
Respuesta:
Para tapar un nucleótido inusual, se agrega metil guanosina trifosfato en el extremo 5 'del hnRNA, mientras que los residuos de adenilato (200-300) (Poli A) se agregan en el extremo 3' de la cola.

Pregunta 32.
Si un ADN de doble hebra tiene un 20% de citosina, calcule el porcentaje de adenina en el ADN.
Respuesta:
Cytdsine = 20, por lo tanto, guanina = 20
Según la regla de Chargaf (A + T) = (G + C) = 100
Porcentaje de timina + adenina = 20 + 20 = 100
(T + A) = (20 + 20) = 100
(T + A) = 100- (20 + 20)
T + A = 100 y # 8211 40
T + A = 60
Por lo tanto, el porcentaje de adenina será 60/2 = 30%.

Pregunta 33.
Mencione las funciones duales de AUG.
Respuesta:
AUG tiene funciones duales. Actúa como un codón iniciador y también codifica el aminoácido metionina.

Pregunta 34.
¿Cuántos codones están implicados en la terminación de la traducción? Nómbralos.
Respuesta:
Tres codones terminan el proceso de traducción. Son UAA, UAG y UGA.

Pregunta 35.
Degeneración del codón & # 8211 comentario.
Respuesta:
Un código degenerado significa que más de un codón triplete podría codificar un aminoácido específico. Por ejemplo, codones GUU, GUC, GUA y código GUG para valina.

Pregunta 36.
Señale las categorías excepcionales a la universalidad del código genético.
Respuesta:
Se observan excepciones a la naturaleza universal del código genético en genomas procariotas mitocondriales y de cloroplasto.

Pregunta 37.
¿Qué son los codones sin sentido?
Respuesta:
UGA, UAA y UAG son los codones sin sentido, que terminan la traducción.

Pregunta 38.
Nombra los codones triplete que codifican

Pregunta 39.
¿Por qué el hnRNA tiene que someterse a un empalme?
Respuesta:
Dado que el hnRNA contiene tanto secuencias codificantes (exones) como secuencias no codificantes (intrones), tiene que someterse a un corte y empalme para eliminar los intrones.

Pregunta 40.
Indique el papel de los siguientes codones en el proceso de traducción.

Pregunta 41.
A continuación se muestra la secuencia de ARNm. Mencione la secuencia de aminoácidos que se forma después de su traducción.
Respuesta:
3’AUGAAAGAUGGGUAA5 ’
Metionina & # 8211 Lisina & # 8211 Ácido aspártico & # 8211 Glicina

Pregunta 42.
Nombra los cuatro codones que codifican la valina.
Respuesta:
GUU, GUC, GUA y GUG.

Pregunta 43.
La secuencia de bases en una de las cadenas de ADN es TAGC ATGAT. Mencione la secuencia de bases en su cadena complementaria.
Respuesta:
La hebra complementaria tiene ATCGTACTA.

Pregunta 44.
¿Por qué el t-ARN se denomina molécula adaptadora?
Respuesta:
La molécula de ARN de transferencia (ARNt) de una célula actúa como un vehículo que recoge los aminoácidos esparcidos por el citoplasma y también lee códigos específicos de moléculas de ARNm. De ahí que se le llame molécula adaptadora.

Pregunta 45.
¿Qué quiere decir con la carga de tRNA? Nombra la enzima involucrada en este proceso.
Respuesta:
El proceso de adición de aminoácidos al tRNA se conoce como aminoacilación o carga y el producto resultante se llama aminoacil-tRNA (tRNA cargado). La aminoacilación es catalizada por una enzima aminoacil y # 8211 tRNA sintetasa.

Pregunta 46.
¿Qué son las UTR?
Respuesta:
El ARNm también tiene algunas secuencias adicionales que no se traducen y se denominan Regiones no traducidas (UTR). Las UTR están presentes tanto en el extremo 5 '(antes del codón de inicio) como en el extremo 3' (después del codón de terminación).

Pregunta 47.
¿Qué es la secuencia S & # 8211 D?
Respuesta:
El extremo 5 'del ARNm de los procariotas tiene una secuencia especial que precede al codón de inicio AUG inicial del ARNm. Este sitio de unión al ribosoma se denomina secuencia Shine & # 8211 Dalgamo o secuencia S-D. Esta secuencia pares de bases con una región del ARN 16Sr de la subunidad ribosómica pequeña que facilita la iniciación.

Pregunta 48.
Definir unidad de traducción.
Respuesta:
Una unidad de traducción en el ARNm es la secuencia de ARN que está flanqueada por el codón de inicio en el extremo 5 'y el codón de terminación en el extremo 3' y los códigos del polipéptido.

Pregunta 49.
Mencione el papel inhibidor de la tetraciclina y la estreptomicina en la traducción bacteriana.
Respuesta:
La tetraciclina inhibe la unión entre el ARNm de aminoacilo y el ARNm. La estreptomicina inhibe el inicio de la traducción y provoca una lectura incorrecta.

Pregunta 50.
¿En qué etapa se regula la expresión génica?
Respuesta:
La expresión génica puede controlarse o regularse a niveles transcripcionales o traduccionales.

Pregunta 51.
¿Qué es un operón? Da un ejemplo.
Respuesta:
El grupo de genes con funciones relacionadas se llama operón.
Por ejemplo: operón lac en E. coli.

Pregunta 52.
Teniendo en cuenta el operón lac de E. coli, nombre los productos de los siguientes genes.

  1. i gen & # 8211 proteína represora
  2. gen lac Z y # 8211 fS-galactosidasa
  3. Gen Lac Y & # 8211 Permease
  4. lac a gen y # 8211 transacetilasa

Pregunta 54.
Nombra el cromosoma humano que tiene

  1. El cromosoma 1 tiene el número máximo de genes (2968 genes)
  2. El cromosoma Y tiene menos genes (231 genes)

Pregunta 55.
¿Qué son los SNP? Mencione sus usos.
Respuesta:
SNP: polimorfismo de un solo nucleótido. Ayuda a encontrar ubicaciones cromosómicas para secuencias asociadas a enfermedades y rastrear la historia humana.

Pregunta 56.
Mencione cuatro áreas en las que se pueden utilizar las huellas dactilares de ADN.
Respuesta:

  1. Análisis forense
  2. Análisis de pedigrí
  3. Conservación de la vida salvaje
  4. Estudios antropológicos

Pregunta 57.
Clasifica el ácido nucleico según las moléculas de azúcar.
Respuesta:
Hay dos tipos de ácidos nucleicos según el tipo de azúcar pentosa. Los que contienen azúcar desoxirribosa se denominan ácido desoxirribonucleico (ADN) y los que contienen azúcar ribosa se conocen como ácido ribonucleico (ARN). La única diferencia entre estos dos azúcares es que hay un átomo de oxígeno menos en la desoxirribosa.

Pregunta 58.
Tanto las purinas como las pirimidinas son bases nitrogenadas, pero difieren. ¿Cómo?
Respuesta:
Tanto las purinas como las pirimidinas son bases nitrogenadas. Las bases de purina adenina y guanina tienen un anillo de nitrógeno de carbono doble y # 8211, mientras que las bases de citosina y timina tienen un anillo de nitrógeno de carbono único.

Pregunta 59.
¿En qué se diferencia el 5 'de ADN de su 3'?
Respuesta:
El 5 ’del ADN se refiere al carbono del azúcar al que está unido el grupo funcional fosfato (P04V). El 3 'del ADN se refiere al carbono del azúcar al que está unido un grupo hidroxilo (OH).

Pregunta 60.
Estado de la regla de Chargaff.
Respuesta:
Según Erwin Chargaff,

  1. La adenina se empareja con la timina con dos enlaces de hidrógeno.
  2. La guanina se empareja con la citosina con tres enlaces de hidrógeno.

Pregunta 61.
Químicamente, el ADN es más estable que el ARN & # 8211 Justificar.
Respuesta:
En el ADN, las dos hebras son complementarias, si se separan (desnaturalizan) por calentamiento pueden unirse (renaturalización) cuando se proporciona la condición apropiada. Además, el grupo 2 OH presente en cada nucleótido del ARN es un grupo reactivo que hace que el ARN sea responsable y fácilmente degradable. También se sabe que el ARN es catalítico y reactivo. Por tanto, el ADN es químicamente más estable y químicamente menos reactivo en comparación con el ARN. La presencia de timina en lugar de uracilo en el ADN confiere estabilidad adicional al ADN.

Pregunta 62.
Escriba en forma simple sobre el modo semiconservador de replicación del ADN.
Respuesta:
La replicación semiconservadora fue propuesta por Watson y Crick en 1953. Este mecanismo de replicación se basa en el modelo de ADN. Sugirieron que las dos cadenas de polinucleótidos de la molécula de ADN se desenrollaran y comenzaran a separarse en un extremo. Durante este proceso, se rompen los enlaces de hidrógeno covalentes. La hebra única separada actúa luego como plantilla para la síntesis de una nueva hebra. Posteriormente, cada doble hélice hija lleva una hebra de polinucleótidos de la molécula madre que actúa como molde y la otra hebra se sintetiza nuevamente y es complementaria a la hebra parental.

Pregunta 63.
Dibuja un diagrama simplificado del nucleosoma y etiquétalo.
Respuesta:

Pregunta 64.
¿Qué es una cartilla?
Respuesta:
Un cebador es un tramo corto de ARN. Inicia la formación de una nueva hebra. El cebador produce el extremo 3'-OH en la secuencia de ribonucleótidos, a los que se agregan desoxirribonucleótidos para formar una nueva hebra.

Pregunta 65.
Ambas cadenas de ADN no se copian durante la transcripción. Dar una razon.
Respuesta:
Ambas cadenas de ADN no se copian durante la transcripción por dos razones.

  1. Si ambas cadenas actúan como plantilla, codificarían ARN con diferentes secuencias. Esto, a su vez, codificaría proteínas con diferentes secuencias de aminoácidos. Esto daría lugar a que un segmento de ADN codificara dos proteínas diferentes, lo que complicaría la maquinaria de transferencia de información genética.
  2. Si se produjeran dos moléculas de ARN simultáneamente, se formaría ARN bicatenario complementario entre sí. Esto evitaría que el ARN se traduzca en proteínas.

Pregunta 66.
¿Qué quiere decir con una cadena de plantilla y una cadena de codificación?
Respuesta:
La ARN polimerasa dependiente de ADN cataliza la polimerización en una sola dirección, la hebra que tiene la polaridad 3 '→ 5' actúa como plantilla y se denomina hebra plantilla. La otra hebra que tiene la polaridad 5 '→ 3' tiene la misma secuencia que el ARN (excepto timina en lugar de uracilo) y se desplaza durante la transcripción. Esta hebra se llama hebra codificante.

Pregunta 67.
Nombre los factores que son responsables del inicio y finalización de la transcripción en procariotas.
Respuesta:

  1. El factor sigma es responsable del inicio de la transcripción.
  2. El factor Rho es responsable de la terminación de la transcripción.

Pregunta 68.
Nombra los principales tipos de ARN de procariotas y menciona su función.
Respuesta:
En los procariotas, hay tres tipos principales de ARN: ARNm, ARNt y ARNr. Los tres ARN son necesarios para sintetizar una proteína en una célula. El ARNm proporciona la plantilla, el ARNt aporta aminoácidos y lee el código genético, y los ARNr juegan un papel estructural y catalítico.
durante la traducción.

Pregunta 69.
Definir código genético.
Respuesta:
El orden de los pares de bases a lo largo de la molécula de ADN controla el tipo y el orden de los aminoácidos que se encuentran en las proteínas de un organismo. Este orden específico de pares de bases se llama código genético.

Pregunta 70.
Explica la hipótesis de Wobble.
Respuesta:
La hipótesis de la oscilación es propuesta por Crick (1966), que establece que el anticodón del ARNt tiene la capacidad de oscilar en su extremo 5 'al emparejarse incluso con una base no complementaria del codón de ARNm. & # 8217 De acuerdo con esta hipótesis, en el emparejamiento de codón-anticodón el La tercera base puede no ser complementaria.

La tercera base del codón se llama base de oscilación y esta posición se llama posición de oscilación. El emparejamiento de bases real se produce solo en las dos primeras posiciones. La importancia de la hipótesis de Wobbling es que reduce el número de ARNt necesarios para la síntesis de polipéptidos y supera el efecto de la degeneración del código.

Pregunta 71.
Explica la naturaleza del ribosoma eucariota.
Respuesta:
Los ribosomas de los eucariotas (80 S) son más grandes y constan de subunidades 60 S y 40 S. "S" denota la sedimentación eficiente que se expresa como unidad de Svedberg (S). La subunidad más grande en eucariotas consiste en una molécula de ARN 23 S y ARN 5Sr y 31 proteínas ribosómicas. La subunidad eucariota más pequeña consta de un componente de ARN 18Sr y aproximadamente 33 proteínas.

Pregunta 72.
Expanda y defina ORF.
Respuesta:
Cualquier secuencia de ADN o ARN que comience con un codón de inicio y que pueda traducirse en una proteína se conoce como marco de lectura abierto (ORF).

Pregunta 73.
¿Cuáles son los componentes del complejo de iniciación de la traducción procariota?
Respuesta:
El inicio de la traducción en E. coli comienza con la formación de un complejo de iniciación, que consta de las subunidades 30S del ribosoma, un ARN mensajero y el ARNt de N-formil metionina cargado (f met -1 ARN f met), tres factores de iniciación proteicos (IF 1, IF2, IF3), GTP (Trifosfato Guaniner) y Mg 2+.

Pregunta 74.
Explica los componentes del operón.
Respuesta:
Estructura del operón: cada operón es una unidad de expresión y regulación génica y consta de
de uno o más genes estructurales y un gen operador adyacente que controla la transcripción
actividad del gen estructural.

  1. El gen estructural codifica proteínas, rRNA y tRNA requeridos por la célula.
  2. Los promotores son las secuencias señal en el ADN que inician la síntesis de ARN. La ARN polimerasa I se une al promotor antes del inicio de la transcripción.
  3. Los operadores están presentes entre los promotores y los genes estructurales. La proteína represora se une a la región operadora del operón.

Pregunta 75.
Describe el experimento de Hershey y Chase. ¿Qué concluye su experimento?
Respuesta:
Alfred Hershey y Martha Chase (1952) realizaron experimentos con bacteriófagos que infectan bacterias. Fago T2 es un virus que infecta a la bacteria Escherichia coli. Cuando se agregan fagos (virus) a las bacterias, se adsorben en la superficie exterior, parte del material ingresa a la bacteria y luego cada bacteria se lisa para liberar una gran cantidad de fagos de la progenie. Hershey y Chase querían observar si era el ADN o la proteína lo que entraba en la bacteria. Todos los ácidos nucleicos contienen fósforo y azufre (en el aminoácido cisteína y metionina). Hershey y Chase diseñaron un experimento utilizando isótopos radiactivos de azufre (35 S) y fósforo (32 P) para realizar un seguimiento separado de la proteína viral y los ácidos nucleicos durante el proceso de infección.

Se permitió que los fagos infectaran bacterias en un medio de cultivo que contenía los isótopos radiactivos 35 S o 32 P. El bacteriófago que creció en presencia de 35 S tenía proteínas marcadas y los bacteriófagos cultivados en presencia de 32 P tenían ADN marcado. Por tanto, el marcaje diferencial les permitió identificar el ADN y las proteínas del fago. Hershey y Chase mezclaron los fagos marcados con E. coli sin marcar y permitieron que los bacteriófagos atacaran e inyectaran su material genético. Poco después de la infección (antes de la lisis de las bacterias), las células bacterianas se agitaron suavemente en un mezclador para aflojar las partículas de la fase adherida.

Se observó que solo se encontró 32 P asociado con células bacterianas y 35 S en el medio circundante y no en las células bacterianas. Cuando se estudió la radioactividad de la progenie del fago, se encontró que solo portaba 32 P y no 35 S. Estos resultados indican claramente que solo el ADN y no la cubierta proteica ingresaron a las células bacterianas. Así, Hershey y Chase demostraron de manera concluyente que era el ADN, no la proteína, lo que transportaba la información hereditaria de virus a bacterias.

Pregunta 76.
Explica las propiedades del ADN que lo convierten en un material genético ideal.
Respuesta:
1. Autorreplicación: debería poder replicarse. De acuerdo con la regla de apareamiento y complementariedad de bases, ambos ácidos nucleicos (ADN y ARN) tienen la capacidad de dirigir duplicaciones. Las proteínas no cumplen con este criterio.

2. Estabilidad: Debe ser estable estructural y químicamente. El material genético debe ser lo suficientemente estable para no cambiar con las diferentes etapas del ciclo de vida, la edad o con los cambios en la fisiología del organismo. La estabilidad como propiedad del material genético era claramente evidente en el principio transformador de Griffith. El calor que mató a las bacterias no destruyó algunas de las propiedades del material genético. En el ADN, las dos hebras son complementarias.

si se separan (desnaturalizan) por calentamiento, pueden unirse (renaturalización) cuando se proporcionan las condiciones adecuadas. Además, el grupo 2 ’OH presente en cada nucleótido del ARN es un grupo reactivo que hace que el ARN sea susceptible y fácilmente degradable. También se sabe que el ARN es catalítico y reactivo. Por tanto, el ADN es químicamente más estable y químicamente menos reactivo en comparación con el ARN. La presencia de timina en lugar de uracilo en el ADN confiere estabilidad adicional al ADN.

3. Almacenamiento de información: debe poder expresarse en forma de "caracteres mendelianos". El ARN puede codificar directamente la síntesis de proteínas y puede expresar fácilmente los caracteres. El ADN, sin embargo, depende del ARN para la síntesis de proteínas. Tanto el ADN como el ARN pueden actuar como material genético, pero el ADN, que es más estable, almacena la información genética y el ARN transfiere la información genética.

4. Variación por mutación: debería poder mutar. Tanto el ADN como el ARN pueden mutar. El ARN es inestable y muta a un ritmo más rápido. Por lo tanto, los virus que tienen un genoma de ARN con una vida útil más corta pueden mutar y evolucionar más rápido. La discusión anterior indica que tanto el ARN como el ADN pueden funcionar como material genético. El ADN es más estable y se prefiere para el almacenamiento de información genética.

Pregunta 77.
¿Cómo se empaqueta el ADN en una célula eucariota? pie
Respuesta:
En eucariotas, la organización es más compleja. La cromatina está formada por una serie de unidades repetidas llamadas nucleosomas. Komberg propuso un modelo para el nucleosoma, en el que 2 moléculas de las cuatro proteínas histonas H2A, H2B, H3 y H4 se organizan para formar una unidad de ocho moléculas llamada histona octamere. El ADN cargado negativamente se envuelve alrededor del octamero de histonas cargadas positivamente para formar una estructura llamada nucleosoma. Un nucleosoma típico contiene 200 pb de hélice de ADN. Los octameros de histonas están en estrecho contacto y el ADN está enrollado en el exterior del nucleosoma. Los nucleosomas vecinos están conectados por ADN enlazador (HI) que está expuesto a enzimas.

El ADN hace dos vueltas completas alrededor de los octameros de histona y las dos vueltas están selladas por una molécula de HI. La cromatina que carece de HI tiene una apariencia de perlas en una cuerda en la que el ADN se interpone y abandona los nucleosomas en lugares aleatorios. El HI de un nucleosoma puede interactuar con 33 l de los nucleosomas vecinos dando como resultado un mayor plegamiento de la fibra.

La fibra de crof y ampatina en núcleos en interfase y cromosomas mitóticos tiene un diámetro que varía entre 200-300 nm y representa cromatina inactiva. La fibra de 30 nm surge del plegado de nucfeosbme, cadenas en una estructura de solenoide que tiene seis nucleosomas por vuelta. Esta estructura se estabiliza mediante la interacción entre diferentes moléculas de HI. El ADN es un solenoide y está empaquetado,%) _ pliegues. Se ilustra la naturaleza jerárquica de la estructura cromosómica.

Se requiere un conjunto adicional de pteínas para el empaquetamiento de cromatina a un nivel superior y se denominan proteínas cromosómicas no histonas (NHC). En *, un núcleo típico, algunas regiones de la cromatina están empaquetadas con Ibosely (ligeramente teñidas) y se denominan eucromatina. La cromatina que está compactada (teñida de forma oscura) se llama heterocromatina. La eucromatina es transcripcionalmente activa y la heterocromatina es transcripcionalmente inactiva.

Pregunta 78.
El experimento de Meselson y Stahl demostró el modo de replicación del ADN de semicofptervación. Explicar.
Respuesta:
El modo de replicación del ADN fue determinado en 1958 por Meselson y Stahl. Diseñaron un experimento para distinguir entre réplicas semiconservadoras, conservadoras y dispersivas. En su experimento, cultivaron dos culturas de E. coli durante muchas generaciones en medios separados. El cultivo "pesado" se hizo crecer en un medio en el que la fuente de nitrógeno (NH4CI) contenía el isótopo pesado 15 N y el cultivo "ligero" se cultivó en un medio en el que la fuente de nitrógeno contenía el isótopo ligero 14 H durante muchas generaciones. Al final del crecimiento, observaron que el ADN bacteriano en el cultivo pesado contenía solo 15 N y en el cultivo ligero solo 14 N. El ADN pesado se pudo distinguir del ADN ligero (15 N de 14 N) con una técnica llamada Cesio. Centrifugación en gradiente de densidad de cloruro (CsCl). En este proceso, el ADN pesado y liviano extraído de las células en trece cultivos se asentaron en dos bandas distintas y separadas (ADN híbrido).

El cultivo pesado (15 N) se transfirió luego a un medio que solo tenía NH4Cl y se tomaron muestras en varios intervalos de tiempo definidos (20 minutos de duración). Después de la primera replicación, extrajeron el ADN y lo sometieron a centrifugación en gradiente de densidad. El ADN se instaló en una banda que tenía una posición intermedia entre las bandas pesadas y ligeras determinadas previamente. Después de la segunda replicación (40 minutos de duración), nuevamente extrajeron muestras de ADN, y esta vez encontraron que el ADN se asentaba en dos bandas, una en la posición de la banda clara y otra en la posición intermedia. Estos resultados confirman la hipótesis de replicación semi & # 8211 conservadora de Watson y Crick.

Pregunta 79.
Dar una descripción detallada de una unidad de transcripción.
Respuesta:
Una unidad transcripcional en el ADN está definida por tres regiones, un promotor, el gen estructural y un terminador. El promotor se encuentra hacia el extremo 5 '. Es una secuencia de ADN que proporciona un sitio de unión para la ARN polimerasa. La presencia de promotor en una unidad de transcripción define la plantilla y las cadenas codificantes. La región del terminador ubicada hacia el extremo 3 'de la cadena codificante contiene una secuencia de ADN que hace que la ARN polimerasa deje de transcribir. En eucariotas, el promotor tiene regiones ricas en AT llamadas caja TATA (caja de Goldberg-Hogness) & # 8216 y en procariotas esta región se llama caja de Pribnow.

Además del promotor, los eucariotas también requieren un potenciador. Las dos hebras del ADN en el gen estructural de una unidad de transcripción tienen polaridad opuesta. La ARN polimerasa dependiente de ADN cataliza la polimerización en una sola dirección, la hebra que tiene la polaridad 3 '→ 5' actúa como plantilla y se denomina hebra plantilla. La otra hebra que tiene la polaridad 5 '→ 3' tiene la misma secuencia que el ARN (excepto timina en lugar de uracilo) y se desplaza durante la transcripción. Esta hebra se llama hebra codificante

El gen estructural puede ser monocistrónico (eucariotas) o policistrónico (procariotas). En eucariotas, cada ARNm lleva solo un gen y codifica información para una sola proteína y se llama ARNm monocistrónico. En los procariotas, los grupos de genes relacionados, conocidos como operón, que a menudo se encuentran uno al lado del otro en el cromosoma, se transcriben juntos para dar un solo ARNm y, por lo tanto, son policistrónicos.

Pregunta 80.
Explique el proceso de transcripción en procariotas con el diagrama necesario.
Respuesta:
En los procariotas, hay tres tipos principales de ARN:
ARNm, ARNt y ARNr. Los tres ARN son necesarios para sintetizar una proteína en una célula. El ARNm proporciona la plantilla, el ARNt aporta aminoácidos y lee el código genético, y los ARNr desempeñan un papel estructural y catalítico durante la traducción. Existe una única ARN polimerasa dependiente de ADN que cataliza la transcripción de todos los tipos de ARN. Se une al promotor e inicia la transcripción (iniciación).

Los sitios de unión de las polimerasas se denominan promotores. Utiliza nucleósido trifosfato como sustrato y polimerasas de forma dependiente de la plantilla siguiendo la regla de complementariedad. Después del inicio de la transcripción, la polimerasa continúa alargando el ARN, agregando un nucleótido tras otro a la cadena de ARN en crecimiento. Solo un tramo corto de ARN permanece unido a la enzima, cuando la polimerasa alcanza un terminador al final de un gen, el ARN naciente se cae, y también la ARN polimerasa. La ARN polimerasa solo es capaz de catalizar el proceso de alargamiento. La ARN polimerasa se asocia transitoriamente con el factor de iniciación sigma (a) y el factor de terminación rho (p) para iniciar y terminar la transcripción, respectivamente.

La asociación de ARN con estos factores instruye a la ARN polimerasa para iniciar o terminar el proceso de transcripción. En las bacterias, dado que el ARNm no requiere ningún procesamiento para activarse y también dado que la transcripción y la traducción tienen lugar simultáneamente en el mismo compartimento (ya que no hay separación del citosol y el núcleo en las bacterias), muchas veces la traducción puede comenzar mucho antes de que el ARNm sea eliminado. totalmente transcrito. Esto se debe a que el material genético no está separado de otros orgánulos celulares por una membrana nuclear, por lo que la transcripción y la traducción pueden acoplarse en bacterias.

Pregunta 81.
Escribe las características más destacadas del código genético.
Respuesta:
Las características más destacadas del código genético son las siguientes:

  1. El codón genético es un código triplete y 61 codones codifican aminoácidos y 3 codones no codifican ningún aminoácido y funcionan como codón de terminación (terminación).
  2. El código genético es universal. Significa que todos los sistemas vivos conocidos usan ácidos nucleicos y los mismos codones de tres bases (codón triplete) dirigen la síntesis de proteínas a partir de aminoácidos. Por ejemplo, el codón del ARNm (UUU) codifica la fenilalanina en todas las células de todos los organismos. Se informan algunas excepciones en genomas procarióticos, mitocondriales y de cloroplasto. Sin embargo, las similitudes son más comunes que las diferencias.
  3. Un codón no superpuesto significa que no se usa la misma letra para dos codones diferentes. Por ejemplo, la secuencia de nucleótidos GUTJ y GUC representa solo dos codones.
  4. No tiene comas, lo que significa que el mensaje se leería directamente de un extremo al otro, es decir, no se necesitan signos de puntuación entre dos códigos.
  5. Un código degenerado significa que más de un codón triplete podría codificar un aminoácido específico. Por ejemplo, codones GUU, GUC, GUA y código GUG para valina.
  6. El código no ambiguo significa que un codón codificará un aminoácido.
  7. El código siempre se lee en una dirección fija, es decir, desde 5 '→ 3' dirección llamada polaridad.
  8. AUG tiene funciones duales. Actúa como un codón iniciador y también codifica el aminoácido metionina.
  9. Los codones UAA, UAG (tirosina) y UGA (triptófano) se designan como codones de terminación (terminación) y también se conocen como codones "sin sentido".

Pregunta 82.
Las mutaciones en el código genético afectan el fenotipo. Describe con un ejemplo.
Respuesta:
El tipo más simple de mutación a nivel molecular es un cambio de nucleótido que sustituye una base por otra.Tales cambios se conocen como sustituciones de bases que pueden ocurrir espontáneamente o debido a la acción de mutágenos. Un ejemplo bien estudiado es la anemia de células falciformes en humanos, que resulta de una mutación puntual de un alelo del gen de la β-hemoglobina (βHb).

Una molécula de hemoglobina consta de cuatro cadenas polipeptídicas de dos tipos, dos cadenas a y dos cadenas P. Cada cadena tiene un grupo hemo en su superficie. Los grupos hemo están involucrados en la unión de oxígeno. La enfermedad de la sangre de Jruman, la anemia de células falciformes, se debe a una hemoglobina anormal. Esta anomalía en la hemoglobina se debe a una sustitución de una sola base en el sexto codón del gen beta globingen de GAG ​​a GTG en la cadena p de la hemoglobina.

Da como resultado un cambio del aminoácido ácido glufeniico a valina en la sexta posición de la cadena p. Este es el ejemplo clásico de mutación puntual que da como resultado el cambio del residuo de aminoácidos ácido glutámico a valina. La hemoglobina mutante sufre una polimerización bajo tensión de oxígeno provocando el cambio en la forma de los glóbulos rojos de bicóncava a una estructura en forma de hoz.

Pregunta 83.
Explique el mecanismo de AteArperon de la E-coli.
Respuesta:
El operón Lac (lactosa): el metabolismo de la lactosa en E. coli requiere tres enzimas: permeasa, P-galactosidasa (P-gat) y transacetilasa. La enzima permeasa es necesaria para la entrada de lactosa en la célula, la Pjgglactosidasa provoca la hidrólisis de lactosa a glucosa y galactosa, mientras que la transacetilatransfiere el grupo acetilo de acetil Co A a P-galactosidasa. El operón lac consta de un gen regulador (el gen T se refiere al inhibidor), sitios promotores (p) y sitio operador (o). Además de estos, tiene tres genes estructurales a saber, lac z, y y lac a. El gen lac "z" codifica la P-gaiaqtttsidasa, el gen lac "y" codifica la permeasa y el gen "a" codifica la transacetilasa.

Jacob y Monod propusieron el modelo clásico del operón Lac para explicar la expresión y regulación génica en E. coli. En lac, un gen estructural policistrónico está regulado por un promotor común y genfc regulador. Cuando la célula usa su fuente de energía normal como glucosa, el gen "i" transcribe un ARNm represor y, después de su traducción, se produce una proteína represora. Se une a la región operadora del operón e impide la traducción, como resultado, no se produce P-galactosidasa. En ausencia de una fuente de carbono preferida, como la glucosa, si la lactosa está disponible como fuente de energía para las bacterias, la lactosa entra en la célula como resultado de la enzima permeasa. La lactosa actúa como inductor e interactúa con el represor para inactivarlo.

La proteína represora se une al operador del operón y evita que la ARN polimerasa transcriba el operón. En presencia de un inductor, como lactosa o alolactosa, el represor se inactiva por interacción con el inductor. Esto permite que la ARN polimerasa se una al sitio del promotor y transcriba el operón para producir ARNm de lac que permite la formación de todas las enzimas necesarias para el metabolismo de la lactosa. Esta regulación del operón lac por el represor es un ejemplo de control negativo del inicio de la transcripción.

Pregunta 84.
¿Cuáles son los objetivos del proyecto Genoma Humano?
Respuesta:
Los principales objetivos del Proyecto Genoma Humano son los siguientes:

  1. Identifique todos los genes (aproximadamente 30000) en el ADN humano.
  2. Determine la secuencia de los tres mil millones de pares de bases químicas que componen el ADN humano.
  3. Almacenar esta información en bases de datos.
  4. Mejorar las herramientas para el análisis de datos.
  5. Transferir tecnologías relacionadas a otros sectores, como industrias.
  6. Abordar las cuestiones éticas, legales y sociales (ELSI) que puedan surgir del proyecto.

Pregunta 85.
Escribe las características más destacadas del Proyecto Genoma Humano.
Respuesta:

  1. Aunque el genoma humano contiene 3 mil millones de bases de nucleótidos, las secuencias de ADN que codifican proteínas constituyen solo alrededor del 5% del genoma.
  2. Un gen promedio consta de 3000 bases, el gen humano más grande conocido es la distrofina con 2,4 millones de bases.
  3. La función del 50% del genoma se deriva de elementos transponibles como la secuencia LINE y ALU.
  4. Los genes se distribuyen en 24 cromosomas. El cromosoma 19 tiene la mayor densidad genética. El cromosoma 13 y el cromosoma Y tienen las densidades de genes más bajas.
  5. La organización cromosómica de los genes humanos muestra diversidad.
  6. Puede haber 35000-40000 genes en el genoma y casi 99,9 bases de nucleótidos son exactamente iguales en todas las personas.
  7. Se desconocen las funciones de más del 50 por ciento de los genes descubiertos.
  8. Menos del 2 por ciento del genoma codifica proteínas.
  9. Las secuencias repetidas constituyen una gran parte del genoma humano. Las secuencias repetitivas no tienen funciones de codificación directa, pero arrojan luz sobre la estructura, dinámica y evolución de los cromosomas (diversidad genética).
  10. El cromosoma 1 tiene 2968 genes, mientras que el cromosoma 'Y' tiene 231 genes.
  11. Los científicos han identificado alrededor de 1,4 millones de ubicaciones, donde las diferencias de ADN de una sola base (SNP & # 8211 Polimorfismo de nucleótido único & # 8211 se pronuncian como "snips") ocurren en humanos. La identificación de "SNIPS" es útil para encontrar ubicaciones cromosómicas para secuencias asociadas a enfermedades y rastrear la historia humana.

Pregunta 86.
Describe el principio involucrado en la técnica de huellas dactilares de ADN.
Respuesta:
La técnica de toma de huellas dactilares de ADN fue desarrollada por primera vez por Alec Jeffreys en 1985. El ADN de una persona y las huellas dactilares son únicos. Hay 23 pares de cromosomas humanos con 1,5 millones de pares de genes. Es un hecho bien conocido que los genes son segmentos de ADN que difieren en la secuencia de sus nucleótidos. No todos los segmentos de ADN codifican proteínas, algunos segmentos de ADN tienen una función reguladora, mientras que otros son secuencias intermedias (intrones) y otros son secuencias de ADN repetidas. En la toma de huellas dactilares de ADN, las secuencias de nucleótidos cortas y repetitivas son específicas de una persona. Estas secuencias de nucleótidos se denominan repeticiones en tándem de número variable (VNTR). Los VNTR de dos personas generalmente muestran variaciones y son útiles como marcadores genéticos.

La impresión digital de ADN implica identificar diferencias en algunas regiones específicas de la secuencia de ADN llamadas ADN repetitivo, porque en estas secuencias, un pequeño tramo de ADN se repite muchas veces. Este ADN repetitivo se separa del ADN genómico en masa como picos diferentes durante la centrifugación en gradiente de densidad. El ADN en masa forma un pico principal y los otros picos pequeños se denominan ADN satélite. Dependiendo de la composición de la base (rica en A: T o rica en G: C), la longitud del segmento y el número de unidades repetitivas, el ADN del satélite se clasifica en muchas subcategorías como microsatélites y minisatélites, etc.

Estas secuencias no codifican ninguna proteína, pero forman una gran parte del genoma humano. Estas secuencias muestran un alto grado de polimorfismo y forman la base de las huellas dactilares del ADN. El ADN aislado de sangre, cabello, células de la piel u otras evidencias genéticas dejadas en la escena de un crimen se puede comparar a través de patrones VNTR, con el ADN de un sospechoso criminal para determinar la culpabilidad o inocencia. Los patrones VNTR también son útiles para establecer la identidad de una víctima de homicidio, ya sea a partir del ADN encontrado como evidencia o del propio cuerpo.

Pregunta 87.
Dibuje un diagrama de flujo que represente los pasos de la técnica de huellas dactilares de ADN
Respuesta:

Preguntas sobre habilidades de pensamiento de orden superior (HOT)

Pregunta 1.
Una hebra de ARNm tiene una serie de codones tripletes, de los cuales los primeros tres codones se dan a continuación.
(a) AGOSTO
(b) UUU
(c) CGU
(i) Nombre el aminoácido codificado por estos codones triplete.
(ii) ¿Menciona la secuencia de ADN a partir de la cual se habrían transcrito estos tripletes de codones?
Respuesta:
(i) Códigos AUG para metionina
Códigos UUU para fenilalanina
Códigos UGC para cisteína
(ii) La secuencia de ADN de TAC se transcribe a AUG
La secuencia AAA de ADN se transcribe a UUU
La secuencia de ADN de ACG se transcribe a UGC

Pregunta 2.
A continuación se muestran las estructuras de las moléculas de ARNt que participan en el proceso de traducción. En un ARNt, se menciona el codón pero no el aminoácido. En otra molécula de ARNt, se nombra el aminoácido y no el codón. Complete la figura mencionando los respectivos aminoácidos y codones.
Respuesta:

Pregunta 3.
Un fragmento de ADN posee 32 bases de adenina y 32 bases de citosina. ¿Cuántos nucleótidos en total contiene ese fragmento de ADN? Explicar.
Respuesta:
128 nucleótidos. Adenine siempre empareja la base de Thymine. Si hay 32 bases de adenina, entonces debe haber 32 bases de timina. De manera similar, la citosina se empareja con la guanina. Si las bases de citosina son 32 en número, las bases de guanina serán iguales a la citosina. Entonces hace un total de 128 nucleótidos.

Pregunta 4.
A continuación se muestra una secuencia de ADN que representa una parte del gen TAC TCG CCC TAT UAA CCC AAA ACC TCT utilizando esta derivación A.

  1. La transcripción de ARN
  2. El ARNm empalmado (considere que todos los codones con dos bases de Aderine son intrones)
  3. El número total de aminoácidos codificados por el ARNm.
  1. Transcripción de ARN: AUG UGC GGG AUA GGG UUU UGG AGA
  2. ARNm empalmado: AUG UGC GGG GGG UUU UGG
  3. 6 aminoácidos están codificados por ARNm

Pregunta 5.
Completa los procesos moleculares nombrándolos

El PDF de Samacheer Kalvi 12th Bio Zoology Chapter Wise Solutions le ayudará a aclarar todas sus dudas. Aprenda perfectamente utilizando Samacheer Kalvi 12. Capítulo 5 Preguntas y respuestas sobre genética molecular Soluciones de bio zoología PDF. Déjanos un comentario para aclarar tus consultas. Obtenga actualizaciones instantáneas marcando nuestro sitio como favorito. Obtenga el mejor aprendizaje con la eficaz y excelente guía paso a paso de Samacheer Kalvi 12th Bio Zoology Guide.


¿Las proteínas contienen fósforo? Si es cierto, ¿cómo Alfred Hershey y Martha Chase utilizaron la afirmación de que las proteínas no contienen fósforo? - biología

178 tarjetas de notas = 45 páginas (4 tarjetas por página)

Vende y Jeans Final

1.) De todas las moléculas de la naturaleza, los ácidos nucleicos son únicos en su capacidad para dirigir su propia replicación. ¿Qué rasgo (s) del ADN hace que tenga esta característica inusual?

La información contenida en una hebra es la misma que en la otra.

2.) ¿Cuál de las siguientes es una afirmación correcta sobre las dos cadenas de ADN en una molécula típica de ADN de doble cadena?

D. Las dos hebras serán antiparalelas entre sí (el extremo de 5 'de una hebra coincidirá con el extremo de 3' de la otra).

3.) Cada nucleótido está compuesto por dos partes constantes (un grupo fosfato y un azúcar pentosa) y una base nitrogenada variable. ¿Cuál de las siguientes opciones no es una diferencia entre el ARN y el ADN?

mi. Los nucleótidos se agregan al extremo 5 'del ARN y al extremo 3' de las moléculas de ADN.

4.) Las ADN polimerasas son enzimas notables tanto por su velocidad como por su precisión. Considere un nucleótido que está siendo agregado por una ADN polimerasa a una cadena de polinucleótidos en crecimiento. ¿En qué posición del azúcar ribosa del nucleótido ya presente se forma un enlace fosfodiéster?

5.) La suma total del contenido de ADN dentro de cada una de las células de un organismo a menudo se denomina "valor C" del organismo. Es razonable suponer que el valor C aumenta de manera proporcional a la complejidad del organismo. ¿Cuál de los siguientes organismos es más probable que tenga el valor C más pequeño?

6.) Las personas con anemia de células falciformes tienen una sola diferencia en la secuencia de aminoácidos de su proteína -globina en relación con las personas que no tienen la enfermedad. La mutación específica, una sustitución, también resultó en el fracaso de una enzima de restricción para generar un fragmento particular de ADN en los individuos afectados. ¿Cuál fue esa mutación?

C. Un cambio que da como resultado la incorporación de una valina en lugar de un ácido glutámico como sexto aminoácido en la proteína -globina.

7.) Aunque solo hay cuatro nucleótidos diferentes en las moléculas de ADN, las células usan el orden específico en el que se encuentran para explicar el orden en el que se usan 20 aminoácidos diferentes para producir proteínas. ¿Cuántos de los 64 códigos de triplete posibles están reservados para su uso como codones de terminación?

8.) El genoma del trigo es aproximadamente cinco veces más grande que el genoma humano. También puede contener más regiones codificantes de proteínas (genes). ¿Cómo puede ser que los humanos podamos producir muchas más proteínas diferentes que el trigo?

B. Los seres humanos hacen muchos más empalmes alternativos que el trigo.

9.) Griffith descubrió que Streptococcus pnemoniae que formaba colonias lisas era capaz de matar ratones, pero que las bacterias de colonias rugosas no. ¿Qué habría encontrado si hubiera infectado ratones solo con el ADN de las bacterias lisas?

Los ratones no se enfermarían.

10.) Los virus que Alfred Hershey y Martha Chase radiomarcaron con isótopos radiactivos de fósforo (32P) y azufre (35S) fueron el bacteriófago T2. Los virus T2, como los virus T4 que destruyen el ADN genómico de su célula huésped como la primera etapa de su ciclo de infección, tienen un exterior elaborado, como un "aterrizador lunar" cuando se ven con un microscopio electrónico. Muchos virus tienen capas externas menos elaboradas, pero ¿de qué biopolímero se construyen todos?

11.) Meselson y Stahl diseñaron un experimento utilizando dos isótopos diferentes de nitrógeno (15N y 14N) que probó la predicción de Watson y Crick de que la replicación del ADN se producía mediante un proceso semiconservador. ¿Qué habrían encontrado después de una ronda de divisiones celulares si la replicación del ADN fuera realmente conservadora?

D. Algunas moléculas de ADN de doble hebra contendrían solo 15N y otras contendrían solo 14N.

12.) El ADN está típicamente presente en las células como una doble hélice que consta de dos cadenas de polinucleótidos. ¿Por qué la información de una hebra de una molécula de ADN es redundante con la de su hebra complementaria?

C. Por cada A y G en una hebra, hay una T y C en la otra.

13.) El mapeo del cromosoma 21 humano (uno de los más pequeños) requirió 198 STS que se utilizaron para seleccionar más de 70.000 clones de YAC e identificar un total de 810 YAC que produjeron una matriz superpuesta de clones que abarcaron todo el cromosoma. ¿Por qué es más conveniente usar clones de cromosomas artificiales de levadura (YAC) para este tipo de mapeo que clones en vectores bacterianos como plásmidos?

D. Las regiones clonadas en los YAC pueden ser muchas veces más grandes que las que se encuentran en los clones bacterianos, por lo que se necesitan menos "pasos" en los recorridos cromosómicos.

14.) Como regla general, los eucariotas son más complejos que los procariotas. ¿Cuál de las siguientes diferencias entre procariotas y eucariotas requiere que las ARN polimerasas eucariotas y los promotores sean sustancialmente más complicadas que sus contrapartes procariotas?

B. Los eucariotas tienen que lograr una regulación específica de tejido de la expresión génica.

15.) Si una hebra de ADN tiene sus bases nitrogenadas dispuestas en este orden: 5 ’- TACGAA - 3’, ¿cuál sería el orden de los nucleótidos en su hebra complementaria?

16.) No pasará mucho tiempo antes de que los médicos usen de forma rutinaria información de la secuencia completa del genoma de sus pacientes. Esa información debería permitir que los medicamentos que están proscritos se adapten al metabolismo particular a fin de tener el máximo efecto con la menor dosis y efectos secundarios posibles. ¿Cómo se llama este tipo de medicina individualizada?

17.) Se puede ver un promedio de tres a cuatro quiasmas a lo largo de cada cromosoma humano durante la profase I de la meiosis. Sin embargo, algunas regiones parecen tener menos probabilidades de formar quiasma que otras. ¿Qué efecto tendría esto en los estudios de mapeo de genes basados ​​en la frecuencia de recombinación en estas regiones?

mi. Los genes que parecen estar relativamente cerca unos de otros pueden estar realmente relacionados de forma distante.

A medida que las células traducen nuevas proteínas, los aminoácidos apropiados son transportados a los ribosomas por una molécula de ARN con una estructura secundaria característica cruciforme (hoja de trébol). ¿Cómo se llaman los miembros de esa familia de moléculas de ARN?

Las proteínas nunca se elaboran directamente a partir de la información almacenada en el ADN. Más bien, la información se transcribe en un intermedio de ARN por la ARN polimerasa. ¿Cuál es el nombre de esos intermedios de ARN?

¿Cuál de los muchos tipos de moléculas de ARN presentes dentro de las células es reconocido específicamente por los ribosomas debido a la presencia de una modificación (la adición de una "tapa", una sola guanina por un enlace inusual de trifosfato de 5 'a 5') en su 5 'final?

A diferencia de los procariotas, los eucariotas modifican ampliamente las transcripciones de ARN de sus genes. ¿Cuáles son los ARN eucariotas destinados a la traducción en proteínas llamados antes de que se complete el procesamiento (es decir, sus intrones aún no se han empalmado o aún no se han poliadenilado)?

. hnRNA (ARN heterogéneos).

22.) Thomas Hunt Morgan en sus estudios con Drosophila fue el primero en darse cuenta de que los rasgos hereditarios (genes) estaban correlacionados con los cromosomas. ¿Cómo pudo conciliar el hecho de que Drosophila parecía tener un número mucho mayor de rasgos que de cromosomas?

C. Descubrió que se codificaban muchos rasgos en cada uno de los cuatro cromosomas.

23.) George Beadle y Edward Tatum utilizaron rayos X para alterar el material genético de un moho de pan rosa. Pruebas posteriores de la capacidad de los moldes para sintetizar los materiales que necesitaban para crecer revelaron que la alteración de genes específicos también alteraba enzimas específicas. Estas observaciones fueron la base de una teoría que les valió un premio Nobel en 1958. ¿Cuál era esa teoría?

C. Por cada enzima de un organismo había un gen.

24.) ¿Cuál es el dogma central de la biología molecular?

La información pasa del ADN al ARN y a la proteína.

25.) Tanto en procariotas como en eucariotas, el primer aminoácido incorporado a todas las proteínas nuevas es la metionina. Dos investigadores encontraron que los ribosomas procarióticos también requerían la secuencia 5’-UAAGGAGG-3 ’(llamada secuencia Shine-Delgarno en su honor) 5’ en un codón de inicio para iniciar la traducción. ¿Qué hace que los ribosomas liberen un ARNm y dejen de agregar aminoácidos a un polipéptido en crecimiento?

C. Cuando los ribosomas encuentran un codón para el que no hay ARNt cargados, dejan de traducir los ARNm.

26.) Jacob y Monod ganaron un premio Nobel en 1961 por su trabajo con diploides parciales y el operón lac. Si una célula procariota tuviera una versión mutante (no funcional) del gen lacI pero una copia normal del gen lacZ, ¿cómo respondería a la presencia y ausencia de lactosa?

mi. Produciría beta galactosidasa tanto en presencia como en ausencia de lactosa.

27.) Una sustancia química cuyo nombre abreviado es IPTG es suficientemente similar a la lactosa para unirse al represor lac pero no puede ser degradado por la enzima -galactosidasa. ¿Qué efecto tendría la presencia de IPTG sobre la expresión del operón lac?

una. El operón lac se expresaría en niveles altos incluso cuando no hubiera lactosa.

28.) El sitio de unión para el producto proteico del gen lacI normalmente se encuentra solo una vez en todo el genoma de E. coli: el operador del operón lac. ¿Qué pasaría si los biólogos moleculares modificaran genéticamente un genoma de E. coli de tal manera que incluyera la secuencia de nucleótidos de ese sitio de unión 50 nucleótidos corriente arriba del promotor del operón trp?

una. No habría ningún efecto sobre la expresión del operón trp.

Las diferentes cepas de Hfr exhiben diferentes orígenes y direcciones de transferencia de su cromosoma bacteriano. El orden de transferencia de genes cercanos al origen (O) de cinco cepas diferentes de Hfr se da a continuación:

Cepa de Hfr / orden de transferencia de genes

¿Cuál de los siguientes es una parte del mapa de conjugación correcto de un cromosoma de E. coli?

30.) Los factores F son uno de los muchos tipos diferentes de plásmidos (fragmentos extracromosómicos de ADN) que se encuentran en los procariotas. ¿Qué estructura exterior que es fundamentalmente importante para el sexo bacteriano codifican la mayoría de los 25 genes de un factor F típico?

31.) Se encontró que una proteína codificada por un gen inmediatamente aguas arriba del operón de lactosa se unía específicamente al promotor frente al gen de la beta-galactosidasa, pero solo cuando no había lactosa presente. Cuando esta proteína se unió, la ARN polimerasa no pudo unirse y comenzar la transcripción del operón lactosa. ¿En qué tipo de regulación de la expresión génica está involucrada esa proteína?

32.) La mayoría de las rutas biológicas requieren que las células posean dos o más enzimas diferentes en cantidades iguales para la conversión eficiente de un material de partida en un producto final. ¿Qué característica de los procariotas ayuda a asegurar la expresión coordinada de genes en tales vías?

B. Los genes con funciones relacionadas se encuentran generalmente en un solo operón.

33.) ¿Cuál de las siguientes opciones no es una diferencia importante entre el cromosoma único de E. coli y los muchos cromosomas de las células humanas?

D. El cromosoma de E. coli tiene regiones largas de secuencia no codificante que interrumpen las regiones codificantes de sus genes.

34.) Cuando el ADN se aísla de células eucariotas, generalmente se encuentra estrechamente asociado con una gran cantidad de proteínas con carga alta positiva llamadas histonas. El hecho de que las histonas sean prácticamente idénticas en una amplia variedad de organismos eucariotas implica que su función debe ser de vital importancia. ¿Cómo se llama el complejo de histonas y ADN en los núcleos eucariotas?

35.) Los seres humanos que son intolerantes a la lactosa ya no producen la enzima equivalente a la beta galactosidasa en el operón lac. ¿Cuál de las siguientes mutaciones en el operón lac de una célula procariota podría hacerla incapaz de sintetizar beta galactosidasa?

Una deleción del codón de inicio.

36.) Por convención, se dice que el primer nucleótido incorporado en un ARNm por una ARN polimerasa es la posición "+1" para ese gen. En los procariotas, se requieren dos conjuntos relativamente bien conservados de secuencias de nucleótidos 35 y 10 pares de bases (pb) cadena arriba de esa posición para que la ARN polimerasa se una y se oriente correctamente. ¿Qué tamaño tienen esas cajas Pribnow y TATA?

37.) Los biólogos moleculares emplearon cuatro enfoques diferentes pero complementarios que obtuvieron la secuencia completa de nucleótidos del genoma humano. Esos enfoques son: mapeo de vínculos, mapeo físico, secuenciación y análisis de secuencia comparativo. ¿En qué se diferencian la vinculación y el mapeo físico?

una. Utilizan análisis de familias y fragmentos de clones, respectivamente.

38.) Sir Alec Jefferies fue la primera persona en ver realmente que la longitud de los ARNm eucariotas era en realidad mucho más corta que los genes que los codificaban cuando hibridó ARNm con ADN genómico y miró los productos con un microscopio electrónico. ¿Cuáles son las porciones de codificación que se cortan y empalman de las transcripciones primarias de genes eucariotas?

39.) El gen de la ovoalbúmina de pollo se expresa exclusivamente en células de oviducto de gallina. ¿Cuál de las siguientes opciones es probable que sea cierta?

una. Estaría en heterocromatina en la mayoría de los tejidos pero en eucromatina en las células del oviducto.

40.) Muchos genomas eucariotas contienen vastas extensiones de ADN no codificante o redundante. Las plantas parecen haber acumulado con frecuencia numerosas duplicaciones de todos sus genomas a lo largo de su historia evolutiva. ¿Qué le sucede a un gen cuya función ya no es necesaria porque su copia cumple su propósito original?

C. Algunos adquieren nuevas funciones que confieren una ventaja selectiva y quedan sometidas a limitaciones funcionales.

41.) Edward Southern fue la primera persona en demostrar que las moléculas de ADN unidas a membranas parecidas al papel podían hibridarse específicamente con otras moléculas de ADN que flotaban libremente y que habían sido marcadas radioactivamente. ¿En cuál de las siguientes características importantes del ADN se basa la técnica de Southern?

C. Las hebras complementarias de ADN monocatenario tienen afinidad entre sí.

42.) Una vez que comienza la traducción, los ribosomas tienen cuidado de moverse a lo largo de las moléculas de ARNm en tres pasos de nucleótidos. ¿Qué pasaría si los ribosomas ignoraran ese marco de lectura?

D. Los aminoácidos aguas abajo del cambio de marco serían incorrectos.

43.) La capacidad de determinar el orden en que aparecen los nucleótidos dentro del ADN de nuestros cromosomas fue obviamente un avance importante en el estudio de la biología, ya que nos permitió examinar directamente nuestro código genético. El primer método de secuenciación de ADN que se utilizó le ganó a Maxam y Gilbert un premio Nobel y fue ampliamente utilizado hasta que Sanger desarrolló un nuevo método aproximadamente diez años después. ¿En qué se diferencian los métodos de Maxam, Gilbert y Sanger?

C. El primero implica la degradación química del ADN, mientras que el de Sanger es un proceso enzimático.

44.) La electroforesis de ADN en gel de agarosa implica el movimiento del ADN en un campo eléctrico a través de los poros de una placa rectangular de agarosa (un material firme similar a la gelatina). Dado que el ADN tiene una carga negativa pronunciada, se mueve naturalmente hacia electrodos positivos cuando se aplica una corriente eléctrica al gel. ¿Cómo se mueven las piezas grandes de ADN en relación con las pequeñas en un sistema así?

una. Más lento porque se enredan más con la matriz de gel.

45.) El descubrimiento en 1974 de un grupo de enzimas en procariotas que rompen cadenas de ADN en secuencias de nucleótidos muy específicas demostró ser invaluable para los investigadores interesados ​​tanto en la clonación como en la secuenciación del ADN. ¿Cómo se denominan enzimas como BamHI que escinde el ADN en la secuencia 5’-GGATCC-3 ’?

46.) La clonación de una oveja, Dolly, a partir de una de sus propias células de la glándula mamaria en 1997 hizo posibles muchas nuevas oportunidades para la biología molecular. ¿Cuál de las siguientes opciones no sería cierta para un clon humano?

B. Tendría los mismos recuerdos que su "padre".

47.) ¿Cuál de los siguientes enumera cosas en orden creciente de tamaño?

D. Aminoácidos, tRNA, mRNA, ribosomas.

48.) Los diabéticos generalmente necesitan dosis regulares de la hormona insulina para sobrevivir. ¿Cuál de las siguientes representa una forma razonable de producir un organismo transgénico que podría proporcionar insulina para tales tratamientos?

mi. Poner un promotor bacteriano delante de la secuencia de ADN de la proteína de insulina humana e insertar esa construcción como parte de un plásmido en una célula bacteriana.

49.) Keri Mullis ganó un Premio Nobel por su descripción de lo que ahora es una metodología muy popular para hacer miles de millones de copias de una porción específica de un genoma a través de ciclos repetidos de calentamiento y enfriamiento del genoma con una polyermasa de ADN, cebadores que flanquean la región de interés y solo unos pocos reactivos adicionales. ¿Cómo se llama este proceso de amplificación?

. Reacción en cadena de la polimerasa (PCR).

50.) La quema de glucosa libera 684 kcal por mol. La síntesis de glucosa es tan desfavorable energéticamente como favorable su combustión. ¿Cómo pueden los seres vivos hacer que la síntesis de glucosa sea una reacción espontánea?

mi. Acoplando las energías desfavorables a reacciones químicas que son energéticamente favorables como la conversión de ATP en ADP y Pi.

51.) Las secuencias de ADN complementarias tienen una afinidad natural entre sí principalmente debido a su capacidad para formar hidrógeno entre sus bases nitrogenadas. Los tres enlaces de hidrógeno que se forman entre las guaninas y las citosinas y los dos que se forman entre las adeninas y las timinas se conocen como "pares de bases". ¿En qué se diferencian estos enlaces de hidrógeno de los enlaces covalentes que conectan una base nitrogenada a un azúcar como la desoxirribosa en el ADN?

D. No necesitan tanta energía para romperse porque en realidad no se comparten electrones.

52.) La mayor parte de la energía extraída de la glucosa durante la glucólisis se recolecta inicialmente en el ciclo del ácido cítrico como NADH. Los electrones de alta energía de NADH se utilizan para crear un gradiente de protones dentro de las mitocondrias. ¿Cuál de los siguientes compuestos ricos en energía es el que se sintetiza como resultado directo de ese gradiente de protones?

53.) Cuando las poblaciones de organismos procariotas coordinan sus actividades, pueden formar comunidades que comienzan a rivalizar con la complejidad de algunos organismos eucariotas. ¿Cómo determinan esas poblaciones de bacterias cuántas bacterias hay cerca?

54.) El pH y el pOH están relacionados entre sí y son escalas logarítmicas. ¿Cuál sería la concentración de iones de hidrógeno en una solución cuyo pOH es 12?

55.) En el primer paso de la glucólisis, un azúcar de seis carbonos, glucosa, interactúa con el ATP y, como resultado, se forma ADP y un azúcar de seis carbonos con un grupo fosfato unido a él. ¿Cómo se llama la enzima que cataliza esa reacción?

56.) Todos los seres vivos de la Tierra usan el mismo conjunto de 20 aminoácidos para construir proteínas. ¿En qué se diferencian esos 20 aminoácidos entre sí?

B. Cada uno tiene su propio grupo R.

57.) El carbono (6C) tiene solo un electrón en cada uno de los cuatro orbitales de su segundo nivel. ¿Cuál de los átomos enumerados a continuación esperaría que fuera mucho más electronegativo que el carbono?

58.) Los componentes de las membranas nucleares que se separan cerca del final de la profase se reutilizan para ensamblar la envoltura nuclear de las células hijas. ¿En qué etapa de la mitosis se forman esas nuevas membranas nucleares?

59.) Los diferentes bloques de construcción utilizados para fabricar cada uno de los cuatro tipos de biopolímeros hacen que cada tipo de macromolécula tenga una función diferente dentro de las células vivas. ¿Cuáles son las funciones principales de los carbohidratos, lípidos, proteínas y ácidos nucleicos?

mi. Transferencia de energía, almacenamiento de energía, catálisis y almacenamiento de información, respectivamente.

60.) Uno de los muchos experimentos genéticos de la mosca de la fruta realizados por Thomas Hunt Morgan involucró el apareamiento de una mosca homocigótica de ojos blancos y cuerpo amarillo (yw / yw) con otra mosca que era heterocigota para esos rasgos (yw / ++). Morgan descubrió que 487 descendientes tenían ojos blancos y cuerpo amarillo, 491 tenían ojos y color de cuerpo normales, 10 tenían ojos blancos y el color del cuerpo era normal y 12 tenían el cuerpo amarillo y el color de ojos normal. ¿A cuántas unidades de mapa se encuentran los genes y y w?

1.) En una serie de experimentos de apareamiento, Thomas Hunt Morgan descubrió que los genes responsables del color negro del cuerpo y los ojos cinabrios en las moscas de la fruta se recombinaban con una frecuencia del 9%. También descubrió que el gen de los ojos cinabrios era de 9,5 unidades de mapa del gen de las alas vestigiales. ¿Qué puedes concluir sobre los genes del color del cuerpo negro y las alas vestigiales?

B. Se recombinan con una frecuencia de 0,5% o 18,5%.

2.) Las aves determinan el sexo de manera diferente a los mamíferos: los gallos son XX y las gallinas XY. Los criadores de pollos a menudo encuentran útil poder determinar el sexo de los polluelos recién nacidos a partir del color de su plumaje. ¿Cómo se puede hacer esto mediante el uso de un alelo (S) dominante ligado al cromosoma X para el plumaje plateado y un alelo (s) recesivo para el plumaje dorado?

C. Los gallos dorados apareados con gallinas plateadas siempre producirán gallinas doradas y gallos plateados.

3.) El ADN es un ácido nucleico "desoxi" porque el grupo hidroxilo del carbono 2 ’de la ribosa se reemplaza por un átomo de hidrógeno. ¿Cuál de los siguientes carbonos también es "desoxi" en los nucleótidos dide-oxi utilizados para el método Sanger de secuenciación del ADN?

4.) Cuanto más separados estén dos genes en un solo cromosoma, es más probable que tengan una forma de complejo sinaptonemal entre ellos durante la meiosis. ¿Por qué la recombinación resultante proporciona una ventaja a los organismos que se reproducen sexualmente?

D. Permite que los genes ventajosos pierdan su asociación con los desventajosos.

5.) Arthur Kornberg fue el primero en aislar de E. coli la enzima que se encarga de replicar el ADN en las células vivas: la ADN polimerasa. ¿Cuál de las siguientes es una descripción correcta del extremo 5 'de una hebra de ADN?

B. El grupo hidroxilo 5 ’(-OH) no está unido a nada más que a un grupo fosfato.

6.) ¿Qué otras características algo sorprendentes de las ADN polimerasas descubrió Arthur Kornberg en el curso de su experimentación?

mi. Deben comenzar con al menos un tramo corto de ADN bicatenario a medida que agregan nucleótidos en una dirección de 5 'a 3'.

7.) Los ácidos nucleicos son inusuales en su capacidad para dirigir su propia replicación. ¿Qué rasgo (s) del ADN hace que tenga esta característica inusual?

B. La información contenida en una hebra es la misma que en la otra.

8.) ¿Cuál de las siguientes es una afirmación correcta sobre las dos cadenas de ADN en una molécula típica de ADN de doble cadena?

D. Las dos hebras serán antiparalelas entre sí (el extremo de 5 'de una hebra coincidirá con el extremo de 3' de la otra).

9.) En 1978, los investigadores confirmaron la hipótesis de Vernon Ingram de que la diferencia de un solo aminoácido en la proteína -globina encontrada en individuos con anemia de células falciformes en relación con aquellos sin la enfermedad se debía a una única diferencia en la secuencia de nucleótidos de ese gen. La mutación específica, una sustitución, también resultó en el fracaso de una enzima de restricción para generar un fragmento particular de ADN en los individuos afectados. ¿Cuál fue esa mutación?

C. La presencia de una A en una posición particular dentro del gen de la -globina de un individuo sano versus la presencia de una T en individuos afectados en la misma posición.

10.) Cada nucleótido se compone de dos partes constantes (un grupo fosfato y un azúcar pentosa) y una base nitrogenada variable. ¿Cuál de las siguientes es una diferencia entre el ARN y el ADN?

C. El ARN se usa para transmitir información a los ribosomas y el ADN se usa para almacenar información.

11.) La suma total del contenido de ADN dentro de cada una de las células de un organismo a menudo se denomina "valor C" del organismo. Como regla general, los valores C se correlacionan con la complejidad del organismo, pero hay excepciones sorprendentes que, en conjunto, se conocen como la paradoja del valor C. ¿Cuál es una conclusión razonable que se puede extraer de la observación de que el genoma de la rana es cientos de veces más grande que el genoma humano?

B. Gran parte del genoma de la rana debe ser "basura".

12.) Griffith descubrió que Streptococcus pneumoniae que formaba colonias lisas era capaz de matar ratones, pero que las bacterias de colonias rugosas no. Una mezcla de bacterias lisas muertas por calor y bacterias ásperas vivas también mató a los ratones. ¿Qué tipo de bacteria encontró en los ratones después de que murieron?

13.) Aunque solo hay cuatro nucleótidos diferentes en las moléculas de ADN, las células usan el orden específico en el que se encuentran para deletrear el orden en el que se usan 20 aminoácidos diferentes para producir proteínas. Hay 64 posibles tripletes de codones con cuatro nucleótidos diferentes. ¿Cuántos posibles tripletes de codones diferentes habría si hubiera seis nucleótidos diferentes?

14.) Como resultado del trabajo de Griffith, Alfred Hershey y Martha Chase virus radiomarcados con isótopos radiactivos de fósforo (32P) y azufre (35S) en 1952. Después de permitir que los virus interactúen con células bacterianas vivas durante aproximadamente medio hora, ¿dónde encontraron el 32P y el 35S?

. Dentro y fuera de las celdas, respectivamente.

15.) Los virus que Alfred Hershey y Martha Chase radiomarcaron con isótopos radiactivos de fósforo (32P) y azufre (35S) fueron el bacteriófago T2. Los virus T2, como los virus T4 que destruyen el ADN genómico de su célula huésped como la primera etapa de su ciclo de infección, tienen un exterior elaborado, como un "aterrizador lunar" cuando se ven con un microscopio electrónico. La capa externa de todos los virus está formada por proteínas. ¿Cuál de las siguientes moléculas podría usarse para almacenar su información genética?

16.) Meselson y Stahl diseñaron un experimento usando dos isótopos diferentes de nitrógeno (15N y 14N) que probó la predicción de Watson y Crick de que la replicación del ADN se producía mediante un proceso semiconservador. ¿Qué habrían encontrado después de una ronda de divisiones celulares si la replicación del ADN fuera realmente conservadora?

D. Algunas moléculas de ADN de doble hebra contendrían solo 15N y otras contendrían solo 14N.

17.) El mapeo del cromosoma 21 humano (uno de los más pequeños) requirió 198 sitios etiquetados de secuencia (STS) que se utilizaron para seleccionar más de 70.000 clones de cromosomas artificiales de levadura (YAC) e identificar un total de 810 YAC que produjeron una matriz superpuesta de clones que abarcan todo el cromosoma. ¿Por qué es más conveniente utilizar los clones de cromosomas artificiales de levadura (YAC) más grandes para este tipo de mapeo que los clones más pequeños en vectores bacterianos como los plásmidos?

D. Cuanto más grandes sean las porciones clonadas de un cromosoma, más fácil será hacer un mapa físico del cromosoma.

18.) Como regla general, los eucariotas son más complejos que los procariotas. ¿Cuál de las siguientes diferencias entre procariotas y eucariotas requiere que las ARN polimerasas eucariotas y los promotores sean sustancialmente más complicadas que sus contrapartes procariotas?

B. Los eucariotas tienen que lograr una regulación específica de tejido de la expresión génica.

19.) Si una hebra de ADN tiene sus bases nitrogenadas dispuestas en este orden: 5 ’- TACGAA - 3’, ¿cuál sería el orden de los nucleótidos en su hebra complementaria?

20.) En el ADN humano, los cuatro nucleótidos están presentes en los siguientes porcentajes: A = 30,2% T = 30,2% G = 19,8% y C = 19,8%. ¿Cómo son estos números consistentes con la regla de Chargaff?

D. La proporción molar de A y T en el ADN es la misma.

¿Cuál de los muchos tipos de moléculas de ARN presentes dentro de las células es reconocido específicamente por los ribosomas debido a la presencia de una modificación (la adición de una "tapa", una sola guanina por un enlace inusual de trifosfato de 5 'a 5') en su 5 'final?

A diferencia de los procariotas, los eucariotas modifican ampliamente las transcripciones de ARN de sus genes. ¿Cuáles son los ARN eucariotas destinados a la traducción en proteínas llamados antes de que se complete el procesamiento (es decir, sus intrones aún no se han empalmado o aún no se han poliadenilado)?

hnRNA (ARN heterogéneos).

A medida que las células traducen nuevas proteínas, los aminoácidos apropiados son transportados a los ribosomas por una molécula de ARN con una estructura secundaria característica cruciforme (hoja de trébol). ¿Cómo se llaman los miembros de esa familia de moléculas de ARN?

Las proteínas nunca se elaboran directamente a partir de la información almacenada en el ADN. Más bien, la información se transcribe en un intermedio de ARN por la ARN polimerasa. ¿Cuál es el nombre de esos intermedios de ARN?

25.) No pasará mucho tiempo antes de que los médicos usen rutinariamente información de la secuencia completa del genoma de sus pacientes. Esa información debería permitir que los medicamentos que están proscritos se adapten al metabolismo particular a fin de tener el máximo efecto con la menor dosis y efectos secundarios posibles. ¿Cómo se llama este tipo de medicina individualizada?

26.) George Beadle y Edward Tatum compartieron un premio Nobel en 1958 por dilucidar la relación precisa entre genes y enzimas. El moho del pan con el que experimentaron generalmente crecía bien en un medio que solo contenía compuestos simples como azúcar, sales y nitrógeno. ¿Por qué algunos de los mutantes auxotróficos que encontraron requerían compuestos adicionales como la arginina en su medio?

mi. Uno o más genes implicados en la síntesis de arginina habían sufrido una mutación.

27.) Tanto en procariotas como en eucariotas, el primer aminoácido incorporado a todas las proteínas nuevas es la metionina. Dos investigadores encontraron que los ribosomas procarióticos también requerían la secuencia 5’-UAAGGAGG-3 ’(llamada secuencia Shine-Delgarno en su honor) 5’ en un codón de inicio para iniciar la traducción. ¿Qué hace que los ribosomas liberen un ARNm y dejen de agregar aminoácidos a un polipéptido en crecimiento?

C. Cuando los ribosomas encuentran un codón para el que no hay ARNt cargados, dejan de traducir los ARNm.

28.) ¿Cuál es el dogma central de la biología molecular?

una. La información pasa del ADN al ARN y a la proteína.

29.) Durante la década de 1960, el código genético fue descifrado por dos grupos de investigación diferentes, uno encabezado por Nirenberg y el otro por Ochoa. Descubrieron que los ribosomas traducían cadenas de poli-uracilo (por ejemplo, 5’-UUUUUUUUU-3 ’) en polipéptidos que solo contenían el aminoácido fenilalanina. ¿Cuál es la secuencia de nucleótidos del anticodón de un ARNt de fenilalanina?

30.) Los análisis genéticos de la utilización de lactosa por E. coli, llevados a cabo por François Jacob y Jacques Monod, proporcionaron los primeros conocimientos importantes sobre la regulación de genes bacterianos y dieron como resultado la acuñación de la palabra "operón". Jacob y Monod descubrieron que los genes esenciales para el metabolismo de la lactosa estaban muy próximos y dispuestos en el cromosoma de E. coli en este orden: beta-galactosidasa, lactosa permeasa y transacetilasa. ¿Qué tenían en común estos genes del primer operón estudiado?

31.) Una sustancia química cuyo nombre abreviado es IPTG es suficientemente similar a la lactosa para unirse al represor lac pero no puede ser degradado por la enzima -galactosidasa. ¿Qué efecto tendría la presencia de IPTG sobre la expresión del operón lac?

B. El operón lac se expresaría en niveles altos incluso cuando no hubiera lactosa.

32.) El sitio de unión para el producto proteico del gen lacI normalmente se encuentra solo una vez en todo el genoma de E. coli: el operador del operón lac. ¿Qué pasaría si los biólogos moleculares modificaran genéticamente un genoma de E. coli de tal manera que incluyera la secuencia de nucleótidos de ese sitio de unión 50 nucleótidos aguas abajo del promotor del operón trp?

C. La expresión del operón trp también estaría asociada con los niveles de lactosa en la célula.

33.) Diferentes cepas de Hfr exhiben diferentes orígenes y direcciones de transferencia de su cromosoma bacteriano. El orden de transferencia de genes cercano al origen (O) de cinco cepas diferentes de Hfr se da a continuación.

Cepa HFR / orden de transferencia de genes

¿Cuál de los siguientes es una parte del mapa de conjugación correcto de un cromosoma de E. coli?

34.) Se ha descubierto que una proteína (proteína receptora de AMP cíclica) se une específicamente al promotor frente al gen de la beta-galactosidasa, pero solo cuando los niveles de glucosa son bajos. Solo cuando esta proteína se une, la ARN polimerasa puede comenzar la transcripción del operón lactosa. ¿En qué tipo de regulación de la expresión génica está involucrada esta proteína?

35.) La mayoría de las rutas biológicas requieren que las células posean dos o más enzimas diferentes en cantidades iguales para la conversión eficiente de un material de partida en un producto final. ¿Qué característica de los procariotas ayuda a asegurar la expresión coordinada de genes en tales vías?

B. Los genes con funciones relacionadas se encuentran generalmente en un solo operón.

36.) ¿Cuál de las siguientes es una diferencia importante entre el cromosoma único de E. coli y los muchos cromosomas de las células humanas?

una. El cromosoma de E. coli es circular, mientras que los cromosomas humanos son lineales.

37.) Los seres humanos que son intolerantes a la lactosa ya no producen la enzima equivalente a la beta galactosidasa en el operón lac. ¿Cuál de las siguientes mutaciones en el operón lac de una célula procariota podría hacerla incapaz de sintetizar beta galactosidasa?

Una deleción del promotor

38.) 70 es un componente importante de la ARN polimerasa de E. coli que reconoce mejor a los promotores que contienen cajas Pribnow y TATA cuyas secuencias son "TTGACA" y "TATAAT", respectivamente. ¿Cómo pueden las ARN polimerasas reconocer y transcribir genes cuyas secuencias promotoras son significativamente diferentes?

mi. Deben ser transcritos por ARN polimerasas con diferentes factores .

39.) El Proyecto Genoma Humano fue un intento ambicioso de compilar una especie de lista de direcciones de dónde residen todos los genes a lo largo de los cromosomas humanos. La finalización de la secuenciación del ADN involucrada en esta "foto lunar de biología molecular" se produjo como resultado de fases previas de mapeo genético y mapeo físico. ¿Cuál fue (y sigue siendo) la cuarta y última fase de este esfuerzo?

mi. Comparar secuencias homólogas encontradas en los genomas de otros organismos para determinar cuáles son funcionalmente importantes y cuál podría ser esa función.

40.) Sir Alec Jefferies fue la primera persona en ver que la longitud de los ARNm eucariotas era en realidad mucho más corta que los genes que los codificaban cuando hibridó ARNm con ADN genómico y observó los productos con un microscopio electrónico. ¿Cuáles son las porciones no codificantes que se cortan y empalman de las transcripciones primarias de genes eucariotas?

41.) Muchos genomas eucariotas contienen vastas extensiones de ADN no codificante o redundante. Las plantas parecen haber acumulado con frecuencia numerosas duplicaciones de todos sus genomas a lo largo de su historia evolutiva. ¿Qué le sucede a un gen cuya función ya no es necesaria porque su copia cumple su propósito original?

C. Algunos adquieren nuevas funciones que confieren una ventaja selectiva y quedan sometidas a limitaciones funcionales.

42.) En 1997, científicos de Edimburgo, Escocia, clonaron un cordero finlandés Dorset adulto. Los investigadores involucrados en este trabajo tuvieron cuidado de usar células mamarias como la fuente del ADN nuclear del cordero que se clonó porque se sabe que están menos diferenciadas que la mayoría de las otras células de mamíferos. ¿Por qué sería necesario utilizar un núcleo de una línea celular indiferenciada en lugar de una diferenciada?

mi. A medida que las células se diferencian, convierten algunas porciones de su cromatina en heterocromatina y ese estado se transmite fielmente a las generaciones posteriores.

43.) Edward Southern fue la primera persona en demostrar que las moléculas de ADN unidas a membranas parecidas al papel podían hibridarse específicamente con otras moléculas de ADN que flotaban libremente y que habían sido marcadas radioactivamente. ¿En cuál de las siguientes características importantes del ADN se basa la técnica de Southern?

C. Las hebras complementarias de ADN monocatenario tienen afinidad entre sí.

44.) La capacidad de determinar el orden en que aparecen los nucleótidos dentro del ADN de nuestros cromosomas fue obviamente un avance importante en el estudio de la biología, ya que nos permitió examinar directamente nuestro código genético. El primer método de secuenciación de ADN que se utilizó le ganó a Maxam y Gilbert un premio Nobel y fue ampliamente utilizado hasta que Sanger desarrolló un nuevo método aproximadamente diez años después. ¿En qué se diferencian los métodos de Maxam, Gilbert y Sanger?

mi. El primero implica la degradación química del ADN, mientras que el de Sanger es un proceso enzimático.

45.) Los diabéticos generalmente necesitan dosis regulares de la hormona insulina para sobrevivir. ¿Cuál de las siguientes representa una forma razonable de producir un organismo transgénico que podría proporcionar insulina para tales tratamientos?

mi. Poner un promotor bacteriano delante de la secuencia de ADN de la proteína de insulina humana e insertar esa construcción como parte de un plásmido en una célula bacteriana.

46.) ¿Cuál de los siguientes enumera cosas en orden creciente de tamaño?

mi. Base nitrogenada, nucleótido, gen, cromosoma.

47.) La enzima de restricción HpaII hace específicamente una ruptura de doble hebra en el ADN siempre que se encuentra con la secuencia de nucleótidos 5’-CCGG-3 ’. Si el genoma humano tiene una longitud aproximada de 3.000.000.000 de nucleótidos, ¿cuántas piezas esperaría que se cortara cuando HpaII cortara en cada uno de sus sitios de restricción?

Aproximadamente 11,700,000 (3,000,000,000 / 256).

48.) 35.000 es una buena estimación del número de genes del genoma humano. Las células humanas utilizan una amplia variedad de mecanismos para expresar diferentes genes en diferentes tejidos. ¿Cuál de los siguientes es probable que sea diferente entre las células del cerebro y del hígado como resultado?

mi. El empaquetado de partes de sus cromosomas.

49.) Keri Mullis ganó un Premio Nobel por su descripción de lo que ahora es una metodología muy popular para hacer miles de millones de copias de una porción específica de un genoma a través de ciclos repetidos de calentamiento y enfriamiento del genoma con una polyermasa de ADN, cebadores que flanquean la región de interés y solo unos pocos reactivos adicionales. ¿Cómo se llama este proceso de amplificación?

. Reacción en cadena de la polimerasa (PCR).

50.) La quema de glucosa libera 684 kcal por mol. La síntesis de glucosa es tan desfavorable energéticamente como favorable su combustión. ¿Cómo pueden los seres vivos hacer que la síntesis de glucosa sea una reacción espontánea?

mi. Acoplando las energías desfavorables a reacciones químicas que son energéticamente favorables como la conversión de ATP en ADP y Pi.

51.) Las secuencias de ADN complementarias tienen una afinidad natural entre sí principalmente debido a su capacidad para formar hidrógeno entre sus bases nitrogenadas. Los tres enlaces de hidrógeno que se forman entre las guaninas y las citosinas y los dos que se forman entre las adeninas y las timinas se conocen como "pares de bases". ¿En qué se diferencian estos enlaces de hidrógeno de los enlaces covalentes que conectan una base nitrogenada a un azúcar como la desoxirribosa en el ADN?

C. No necesitan tanta energía para romperse porque en realidad no se comparten electrones.

52.) La mayor parte de la energía extraída de la glucosa durante la glucólisis se recolecta inicialmente en el ciclo del ácido cítrico como NADH. Los electrones de alta energía de NADH se utilizan para crear un gradiente de protones dentro de las mitocondrias. ¿Cuál de los siguientes compuestos ricos en energía es el que se sintetiza como resultado directo de ese gradiente de protones?

53.) Cuando las poblaciones de organismos procariotas coordinan sus actividades, pueden formar comunidades que comienzan a rivalizar con la complejidad de algunos organismos eucariotas. ¿Cómo determinan esas poblaciones de bacterias cuántas bacterias hay cerca?

54.) Las células suelen utilizar membranas para crear una variedad de microambientes en los que pueden tener lugar reacciones de otro modo incompatibles. ¿Cuál de los siguientes compartimentos intracelulares está realmente envuelto por una membrana doble que puede reflejar el hecho de que alguna vez fue un organismo de vida libre que ahora vive simbióticamente en células eucariotas?

55.) En eucariotas, los procesos de glucólisis y el ciclo del ácido cítrico están físicamente separados por compartimentos de membrana. Las moléculas de NADH y FADH generadas en las mitocondrias durante el ciclo del ácido cítrico llevan consigo la mayor parte de la energía cosechable de la glucosa. ¿Cuál es la molécula que entra en el ciclo del ácido cítrico con tanta energía asociada?

C. Molécula de dos carbonos unida a la coenzima A (acetly-CoA).

56.) La oxidación completa de la glucosa libera una gran cantidad de energía en las células vivas: un cambio neto de –686 kcal / mol. Las células convierten la mayor cantidad posible de esa energía en moléculas de ATP ricas en energía que se utilizan para impulsar una gran cantidad de otras reacciones químicas. La hidrólisis de ATP a ADP y fosfato inorgánico tiene un cambio de energía libre de –7,3 kcal / mol. ¿Cuál es la cantidad neta de energía que cosechan las células en el curso de la conversión de glucosa en piruvato al final de la glucólisis?

57.) La fotosíntesis es un proceso altamente organizado que se divide en etapas principales. Un conjunto de reacciones produce ATP y NADPH, además de liberar oxígeno gaseoso (O2). El otro grupo utiliza moléculas de ATP y NADPH ricas en energía para sintetizar carbohidratos. ¿Cuál de estos conjuntos de reacciones puede continuar teniendo lugar en ausencia de luz?

58.) Los componentes de las membranas nucleares que se separan cerca del final de la profase se reutilizan para ensamblar la envoltura nuclear de las células hijas. ¿En qué etapa de la mitosis se forman esas nuevas membranas nucleares?

59.) Los diferentes bloques de construcción utilizados para fabricar cada uno de los cuatro tipos de biopolímeros hacen que cada tipo de macromolécula tenga una función diferente dentro de las células vivas. ¿Cuáles son las funciones principales de los carbohidratos, lípidos, proteínas y ácidos nucleicos?

mi. Transferencia de energía, almacenamiento de energía, catálisis y almacenamiento de información, respectivamente.

60.) Suponga que el color de la semilla (G / g) y la forma de la semilla (S / s) están codificados por dos genes diferentes pero vinculados en una especie de frijol recién aislada. Un cruce entre una planta con semillas verdes (GG) lisas (SS) y una planta con semillas amarillas (gg) arrugadas (ss) da una generación F1 en la que todos los individuos tienen semillas verdes (Gg) lisas (Ss). En una generación F2 se observan 50 plantas de color verde liso, 30 plantas de arrugas amarillas, 10 plantas de arrugas verdes y 10 plantas de color amarillo liso. ¿Cuántas unidades de mapa separan los genes del color y la forma de las semillas en esta especie de frijoles?


¿Las proteínas contienen fósforo? Si es cierto, ¿cómo Alfred Hershey y Martha Chase utilizaron la afirmación de que las proteínas no contienen fósforo? - biología

Al final de esta sección, podrá hacer lo siguiente:

  • Explicar la transformación del ADN.
  • Describir los experimentos clave que ayudaron a identificar que el ADN es el material genético.
  • Enunciar y explicar las reglas de Chargaff.

Nuestra comprensión actual del ADN comenzó con el descubrimiento de ácidos nucleicos seguido del desarrollo del modelo de doble hélice. En la década de 1860, Friedrich Miescher ((Figura)), médico de profesión, aisló sustancias químicas ricas en fosfato de los glóbulos blancos (leucocitos). Él nombró a estos químicos (que eventualmente se conocerían como ADN) nucleina porque se aislaron de los núcleos de las células.

Figura 1. Friedrich Miescher (1844-1895) descubrió los ácidos nucleicos.

Enlace al aprendizaje

Para ver a Miescher realizar su experimento que lo llevó a descubrir el ADN y las proteínas asociadas en el núcleo, haga clic en esta revisión.

Medio siglo después, en 1928, el bacteriólogo británico Frederick Griffith informó de la primera demostración de transformación bacteriana, un proceso en el que una célula absorbe el ADN externo, cambiando así su morfología y fisiología. Griffith realizó sus experimentos con Steotococos neumonia, una bacteria que causa neumonía. Griffith trabajó con dos cepas de esta bacteria llamadas rugosa (R) y suave (S). (Los dos tipos de células se denominaron "rugosas" y "lisas" después de la aparición de sus colonias cultivadas en una placa de agar nutritivo).

La cepa R no es patógena (no causa enfermedad). La cepa S es patógena (causa de enfermedad) y tiene una cápsula fuera de su pared celular. La cápsula permite que la célula escape a las respuestas inmunitarias del ratón huésped.

Cuando Griffith inyectó la cepa S viva en ratones, murieron de neumonía. Por el contrario, cuando Griffith inyectó la cepa R viva en ratones, sobrevivieron. En otro experimento, cuando inyectó a ratones con la cepa S muerta por calor, también sobrevivieron. Este experimento mostró que la cápsula por sí sola no fue la causa de la muerte. En una tercera serie de experimentos, se inyectó a ratones una mezcla de cepa R viva y cepa S muerta por calor y, para su sorpresa, los ratones murieron. Tras aislar las bacterias vivas del ratón muerto, solo se recuperó la cepa de bacterias S. Cuando se inyectó esta cepa S aislada en ratones frescos, los ratones murieron. Griffith concluyó que algo había pasado de la cepa S muerta por calor a la cepa R viva y la transformó en la cepa S patógena. Llamó a esto el principio transformador ((Figura)). Estos experimentos se conocen ahora como experimentos de transformación de Griffith.

Figura 2. Se utilizaron dos cepas de S. pneumoniae en los experimentos de transformación de Griffith. La cepa R no es patógena, mientras que la cepa S es patógena y causa la muerte. Cuando Griffith inyectó a un ratón la cepa S muerta por calor y una cepa R viva, el ratón murió. La cepa S se recuperó del ratón muerto. Griffith concluyó que algo había pasado de la cepa S muerta por calor a la cepa R, transformando la cepa R en la cepa S en el proceso. (crédito & # 8220living mouse & # 8221: modificación del trabajo por NIH credit & # 8220dead mouse & # 8221: modificación del trabajo por Sarah Marriage)

Los científicos Oswald Avery, Colin MacLeod y Maclyn McCarty (1944) estaban interesados ​​en explorar más este principio transformador. Aislaron la cepa S de los ratones muertos y aislaron las proteínas y los ácidos nucleicos (ARN y ADN), ya que eran posibles candidatos para la molécula de la herencia. Usaron enzimas que degradaban específicamente cada componente y luego usaron cada mezcla por separado para transformar la cepa R. Descubrieron que cuando el ADN se degradaba, la mezcla resultante ya no podía transformar las bacterias, mientras que todas las demás combinaciones podían transformar las bacterias. Esto los llevó a concluir que el ADN era el principio transformador.

Conexión profesional

Los científicos forenses utilizaron pruebas de análisis de ADN por primera vez para resolver un caso de inmigración. La historia comenzó con un adolescente que regresaba a Londres desde Ghana para estar con su madre. Las autoridades de inmigración en el aeropuerto sospecharon de él, pensando que viajaba con un pasaporte falso. Después de mucha persuasión, se le permitió irse a vivir con su madre, pero las autoridades de inmigración no abandonaron el caso en su contra. Se proporcionaron a las autoridades todo tipo de pruebas, incluidas fotografías, pero no obstante se iniciaron los procedimientos de deportación. Casi al mismo tiempo, el Dr. Alec Jeffreys de la Universidad de Leicester en el Reino Unido había inventado una técnica conocida como huellas dactilares de ADN. Las autoridades de inmigración se acercaron al Dr. Jeffreys en busca de ayuda. Tomó muestras de ADN de la madre y tres de sus hijos, así como de una madre sin parentesco, y comparó las muestras con el ADN del niño. Debido a que el padre biológico no estaba en la imagen, el ADN de los tres niños se comparó con el ADN del niño. Encontró una coincidencia en el ADN del niño tanto para la madre como para sus tres hermanos. Llegó a la conclusión de que el niño era de hecho el hijo de la madre.

Los científicos forenses analizan muchos elementos, incluidos documentos, escritura a mano, armas de fuego y muestras biológicas. Analizan el contenido de ADN del cabello, el semen, la saliva y la sangre, y lo comparan con una base de datos de perfiles de ADN de delincuentes conocidos. El análisis incluye el aislamiento, la secuenciación y el análisis de secuencias de ADN. Se espera que los científicos forenses se presenten en las audiencias de la corte para presentar sus hallazgos. Por lo general, se emplean en los laboratorios de delitos de las agencias gubernamentales de la ciudad y el estado. Los genetistas que experimentan con técnicas de ADN también trabajan para organizaciones científicas y de investigación, industrias farmacéuticas y laboratorios universitarios. Los estudiantes que deseen seguir una carrera como científico forense deben tener al menos una licenciatura en química, biología o física, y preferiblemente algo de experiencia trabajando en un laboratorio.

Aunque los experimentos de Avery, McCarty y McLeod habían demostrado que el ADN era el componente informativo transferido durante la transformación, todavía se consideraba que el ADN era una molécula demasiado simple para transportar información biológica.Las proteínas, con sus 20 aminoácidos diferentes, se consideraron candidatos más probables. El experimento decisivo, realizado por Martha Chase y Alfred Hershey en 1952, proporcionó evidencia confirmatoria de que el ADN era de hecho el material genético y no las proteínas. Chase y Hershey estaban estudiando un bacteriófago, un virus que infecta a las bacterias. Los virus suelen tener una estructura simple: una cubierta de proteína, llamada cápside, y un núcleo de ácido nucleico que contiene el material genético (ya sea ADN o ARN). El bacteriófago infecta la célula bacteriana huésped al adherirse a su superficie y luego inyecta sus ácidos nucleicos dentro de la célula. El ADN del fago hace múltiples copias de sí mismo utilizando la maquinaria del huésped y, finalmente, la célula huésped estalla, liberando una gran cantidad de bacteriófagos. Hershey y Chase seleccionaron elementos radiactivos que distinguirían específicamente la proteína del ADN en las células infectadas. Etiquetaron un lote de fagos con azufre radiactivo, 35 S, para marcar la cubierta de proteína. Otro lote de fagos se marcó con fósforo radiactivo, 32 P. Dado que el fósforo se encuentra en el ADN, pero no en la proteína, el ADN y no la proteína se marcaría con fósforo radioactivo. Asimismo, el azufre está ausente en el ADN, pero está presente en varios aminoácidos como la metionina y la cisteína.

Se permitió que cada lote de fagos infectara las células por separado. Después de la infección, la suspensión bacteriana del fago se colocó en un mezclador, lo que provocó que la capa del fago se separara de la célula huésped. A continuación, se examinaron las células expuestas el tiempo suficiente para que ocurriera la infección para ver cuál de las dos moléculas radiactivas había entrado en la célula. La suspensión de fagos y bacterias se centrifugó en una centrífuga. Las células bacterianas más pesadas se asentaron y formaron un sedimento, mientras que las partículas de fagos más ligeros permanecieron en el sobrenadante. En el tubo que contenía el fago marcado con 35 S, el sobrenadante contenía el fago marcado radiactivamente, mientras que no se detectó radiactividad en el sedimento. En el tubo que contenía el fago marcado con 32 P, se detectó radiactividad en el sedimento que contenía las células bacterianas más pesadas y no se detectó radiactividad en el sobrenadante. Hershey y Chase concluyeron que fue el ADN del fago el que se inyectó
en la célula y transportaba información para producir más partículas de fagos, lo que proporciona evidencia de que el ADN era el material genético y no las proteínas ((Figura)).

Figura 3. En los experimentos de Hershey y Chase, las bacterias se infectaron con fagos radiomarcados con 35S, que marca la proteína, o 32P, que marca el ADN. Solo 32P ingresó a las células bacterianas, lo que indica que el ADN es el material genético.

Por esta misma época, el bioquímico austriaco Erwin Chargaff examinó el contenido de ADN en diferentes especies y descubrió que las cantidades de adenina, timina, guanina y citosina no se encontraban en cantidades iguales, y que las concentraciones relativas de las cuatro bases de nucleótidos variaban de una especie a otra. a especies, pero no dentro de tejidos del mismo individuo o entre individuos de la misma especie. También descubrió algo inesperado: que la cantidad de adenina era igual a la cantidad de timina y la cantidad de citosina era igual a la cantidad de guanina (es decir, A = T y G = C). Diferentes especies tenían cantidades iguales de purinas (A + G) y pirimidinas (T + C), pero diferentes proporciones de A + T a G + C. Estas observaciones se conocieron como reglas de Chargaff. Los hallazgos de Chargaff & # 8217 resultaron inmensamente útiles cuando Watson y Crick se estaban preparando para proponer su modelo de doble hélice de ADN. Después de leer las últimas páginas, puede ver cómo la ciencia se basa en descubrimientos anteriores, a veces en un proceso lento y laborioso.

Resumen de la sección

El ADN fue aislado por primera vez de los glóbulos blancos por Friedrich Miescher, quien lo llamó nucleína porque estaba aislado de los núcleos. Frederick Griffith & # 8217s experimentos con cepas de steotococos neumonia proporcionó el primer indicio de que el ADN puede ser el principio transformador. Avery, MacLeod y McCarty demostraron que el ADN es necesario para la transformación de bacterias. Experimentos posteriores de Hershey y Chase utilizando el bacteriófago T2 demostraron que el ADN es el material genético. Chargaff descubrió que la proporción de A = T y C = G, y que el contenido porcentual de A, T, G y C es diferente para diferentes especies.

Preguntas de revisión

Si se analizó el ADN de una especie en particular y se encontró que contiene 27 por ciento de A, ¿cuál sería el porcentaje de C?


Conceptos básicos de la replicación del ADN

Figura 4. Los tres modelos sugeridos de replicación del ADN. El gris indica las cadenas de ADN originales y el azul indica el ADN recién sintetizado.

La elucidación de la estructura de la doble hélice proporcionó una pista de cómo el ADN se divide y hace copias de sí mismo. Este modelo sugiere que las dos hebras de la doble hélice se separan durante la replicación, y cada hebra sirve como plantilla a partir de la cual se copia la nueva hebra complementaria. Lo que no quedó claro fue cómo se llevó a cabo la replicación. Se sugirieron tres modelos: conservador, semiconservador y dispersivo (ver Figura 4).

En la replicación conservadora, el ADN parental permanece unido y las hebras hijas recién formadas están juntas. El método semiconservador sugiere que cada una de las dos hebras de ADN parental actúa como plantilla para que el nuevo ADN se sintetice después de la replicación, cada ADN de doble hebra incluye una hebra parental o "antigua" y una hebra "nueva". En el modelo dispersivo, ambas copias de ADN tienen segmentos bicatenarios de ADN parental y ADN recién sintetizado intercalados.

Meselson y Stahl estaban interesados ​​en comprender cómo se replica el ADN. Crecieron E. coli durante varias generaciones en un medio que contiene un isótopo "pesado" de nitrógeno (15 N) que se incorpora a las bases nitrogenadas y, finalmente, al ADN (Figura 5).

Figura 5. Meselson y Stahl experimentaron con E. coli cultivada primero en nitrógeno pesado (15 N) y luego en 14 N. El ADN cultivado en 15 N (banda roja) es más pesado que el ADN cultivado en 14 N (banda naranja), y sedimenta hasta un nivel más bajo en la solución de cloruro de cesio en una ultracentrífuga. Cuando el ADN cultivado en 15 N se cambia a un medio que contiene 14 N, después de una ronda de división celular, el ADN se sedimenta a la mitad entre los niveles de 15 N y 14 N, lo que indica que ahora contiene el cincuenta por ciento de 14 N. cantidad de ADN contiene solo 14 N. Estos datos apoyan el modelo de replicación semiconservador. (crédito: modificación del trabajo de Mariana Ruiz Villareal)

los E. coli A continuación, el cultivo se cambió a un medio que contenía 14 N y se dejó crecer durante una generación. Se recogieron las células y se aisló el ADN. El ADN se centrifugó a altas velocidades en una ultracentrífuga. Se permitió que algunas células crecieran durante un ciclo de vida más en 14 N y se centrifugaron de nuevo. Durante la centrifugación en gradiente de densidad, el ADN se carga en un gradiente (típicamente una sal como cloruro de cesio o sacarosa) y se centrifuga a altas velocidades de 50.000 a 60.000 rpm. En estas circunstancias, el ADN formará una banda según su densidad en el gradiente. El ADN cultivado en 15 N se agrupará en una posición de densidad más alta que el cultivado en 14 N. Meselson y Stahl notaron que después de una generación de crecimiento en 14 N después de haber sido desplazados de 15 N, la única banda observada tenía una posición intermedia en entre el ADN de las células cultivadas exclusivamente en 15 N y 14 N. Esto sugirió un modo de replicación semiconservador o dispersivo. El ADN recolectado de células cultivadas durante dos generaciones en 14 N formó dos bandas: una banda de ADN estaba en la posición intermedia entre 15 N y 14 N, y la otra correspondía a la banda de ADN 14 N. Estos resultados solo podrían explicarse si el ADN se replica de manera semiconservadora. Por tanto, se descartaron los otros dos modos.

Durante la replicación del ADN, cada una de las dos hebras que forman la doble hélice sirve como plantilla a partir de la cual se copian las nuevas hebras. La nueva hebra será complementaria a la hebra parental o "antigua". Cuando se forman dos copias de ADN hijas, tienen la misma secuencia y se dividen por igual en las dos células hijas.


De descubrir a comprender

Podría parecer que el papel del ADN como portador de información genética no se comprendió hasta mediados de la década de 1940, cuando Oswald Avery (1877-1955) y sus colegas demostraron que el ADN podía transformar bacterias (Avery et al, 1944). Aunque estos experimentos proporcionaron evidencia directa de la función del ADN, las primeras ideas de que podría tener un papel importante en procesos como la proliferación celular, la fertilización y la transmisión de rasgos hereditarios ya se habían presentado más de medio siglo antes. Friedrich Miescher (1844-1895 Fig. 1), el científico suizo que descubrió el ADN en 1869 (Miescher, 1869a), desarrolló teorías sorprendentemente perspicaces para explicar su función y cómo las moléculas biológicas podrían codificar información. Aunque sus ideas eran incorrectas desde el punto de vista actual, su trabajo contiene conceptos que se acercan tentadoramente a nuestra comprensión actual. Pero la carrera de Miescher también contiene lecciones más allá de sus conocimientos científicos. Es la historia de un científico brillante que va camino de hacer uno de los descubrimientos más fundamentales en la historia de la ciencia, que finalmente no alcanzó su potencial porque se aferró a las teorías establecidas y no pudo seguir adelante con la interpretación de sus hallazgos. bajo una nueva luz.

... un científico brillante en camino de hacer uno de los descubrimientos más fundamentales en la historia de la ciencia [...] no alcanzó su potencial porque se aferró a las teorías establecidas ...

Es una curiosa coincidencia en la historia de la genética que tres de los descubrimientos más decisivos en este campo ocurrieran en una década: en 1859, Charles Darwin (1809-1882) publicó Sobre el origen de las especies mediante la selección natural, en el que expuso el mecanismo que impulsa la evolución de las especies siete años más tarde, apareció el artículo de Gregor Mendel (1822-1884) que describe las leyes básicas de la herencia y, a principios de 1869, Miescher descubrió el ADN. Sin embargo, aunque la magnitud de la teoría de Darwin se comprendió casi de inmediato, y al menos el propio Mendel parece haber comprendido la importancia de su trabajo, a menudo se considera que Miescher ignora el significado de su descubrimiento. Pasarían otros 75 años antes de que Oswald Avery, Colin MacLeod (1909–1972) y Maclyn McCarthy (1911–2005) pudieran demostrar de manera convincente que el ADN era el portador de información genética, y otra década antes de que James Watson y Francis Crick (1916–2004) ) desentrañó su estructura (Watson & Crick, 1953), allanando el camino para nuestra comprensión de cómo el ADN codifica la información y cómo esta se traduce en proteínas. Pero Miescher ya tenía conocimientos asombrosos sobre la función del ADN.

Entre 1868 y 1869, Miescher trabajó en la Universidad de Tübingen en Alemania (Figs. 2, 3), donde trató de comprender la base química de la vida. Una diferencia crucial en su enfoque en comparación con los intentos anteriores fue que trabajó con células aisladas (leucocitos que obtuvo del pus) y luego núcleos purificados, en lugar de órganos o tejidos completos. Los protocolos innovadores que desarrolló le permitieron investigar la composición química de un orgánulo aislado (Dahm, 2005), lo que redujo significativamente la complejidad de su material de partida y le permitió analizar sus constituyentes.

En experimentos cuidadosamente diseñados, Miescher descubrió el ADN, o "Nucleína", como él lo llamó, y demostró que se diferenciaba de las otras clases de moléculas biológicas conocidas en ese momento (Miescher, 1871a). En particular, la composición elemental de nuclein con su alto contenido de fósforo lo convenció de que había descubierto una sustancia sui generis, es decir, de su propio tipo, una conclusión posteriormente confirmada por el mentor de Miescher en Tubinga, el eminente bioquímico Felix Hoppe-Seyler (1825-1895 Hoppe-Seyler, 1871 Miescher, 1871a). Después de sus análisis iniciales, Miescher estaba convencido de que la nucleína era una molécula importante y sugirió en su primera publicación que “merecería ser considerada igual a las proteínas” (Miescher, 1871a).

Además, Miescher reconoció inmediatamente que la nucleína podría usarse para definir el núcleo (Miescher, 1870). Este fue un descubrimiento importante, ya que en ese momento la identificación inequívoca de los núcleos y, por lo tanto, su estudio, a menudo era difícil o incluso imposible de lograr porque su morfología, localización subcelular y propiedades de tinción diferían entre tejidos, tipos de células y estados de las células. En cambio, Miescher propuso basar la caracterización de los núcleos en la presencia de esta molécula (Miescher, 1870, 1874). Además, sostuvo que el núcleo debería definirse por propiedades relacionadas con su actividad fisiológica, que creía que estaba estrechamente ligada a la nucleína. Así, Miescher había dado un importante primer paso hacia la definición de un orgánulo en términos de su función más que de su apariencia.

Es importante destacar que sus hallazgos también mostraron que el núcleo es químicamente distinto del citoplasma en un momento en que muchos científicos aún asumían que no había nada único en este orgánulo. De este modo, Miescher allanó el camino para la posterior comprensión de que las células se subdividen en compartimentos con una composición y funciones moleculares distintas. Sobre la base de sus observaciones de que la nucleína parecía capaz de separarse del "protoplasma" (citoplasma), Miescher incluso llegó a sugerir la "posibilidad de que [la nucleína se pueda] distribuir en el protoplasma, que podría ser el precursor de algunos de los de novo formaciones de núcleos ”(Miescher, 1874). Parecía anticipar que el núcleo se vuelve a formar alrededor de los cromosomas después de la división celular, pero desafortunadamente no dio más detalles sobre las condiciones en las que esto podría ocurrir. Por tanto, es imposible saber con certeza a qué circunstancias se refería.

De este modo, Miescher allanó el camino para la posterior comprensión de que las células se subdividen en compartimentos con una composición y funciones moleculares distintas.

En este contexto, es interesante notar que en 1872, Edmund Russow (1841–1897) observó que los cromosomas parecían disolverse en soluciones básicas. Curiosamente, Miescher también había descubierto que podía precipitar nucleína mediante el uso de ácidos y luego devolverla a la solución aumentando el pH (Miescher, 1871a). En ese momento, sin embargo, no estableció el vínculo entre la nucleína y la cromatina. Esto sucedió alrededor de una década después, en 1881, cuando Eduard Zacharias (1852-1911) estudió la naturaleza de los cromosomas usando algunos de los mismos métodos que Miescher había usado para caracterizar la nucleína. Zacharias descubrió que los cromosomas, como la nucleína, eran resistentes a la digestión por las soluciones de pepsina y que la cromatina desaparecía cuando extraía las células tratadas con pepsina con soluciones alcalinas diluidas. Esto llevó a Walther Flemming (1843-1905) a especular en 1882 que la nucleína y la cromatina son idénticas (Mayr, 1982).

Por desgracia, Miescher no estaba convencido. Su renuencia a aceptar estos desarrollos se basaba, al menos en parte, en un profundo escepticismo hacia los métodos —y, por tanto, los resultados— de los citólogos e histólogos, que, según Miescher, carecían de la precisión de los enfoques químicos cuando los aplicaba. Sin embargo, el hecho de que el ADN estuviera vinculado de manera crucial a la función del núcleo estaba firmemente establecido en la mente de Miescher y en los años siguientes trató de obtener pruebas adicionales. Más tarde escribió: "Sobre todo, utilizando una variedad de muestras de plantas y animales adecuadas, quiero demostrar que la nucleína pertenece realmente específicamente a la vida del núcleo" (Miescher, 1876).

Aunque la naturaleza ácida del ADN, su gran peso molecular, su composición elemental y su presencia en el núcleo son algunas de sus propiedades centrales, todas determinadas por primera vez por Miescher, no revelan nada sobre su función. Habiéndose convencido a sí mismo de que había descubierto un nuevo tipo de molécula, Miescher rápidamente se propuso comprender su papel en diferentes contextos biológicos. Como primer paso, determinó que la nucleína se encuentra en una variedad de tipos de células. Desafortunadamente, no dio más detalles sobre los tipos de tejido o las especies de las que se derivaron sus muestras. Los únicos indicios sobre los especímenes con los que trabajó provienen de las cartas que escribió a su tío, el anatomista suizo Wilhelm His (1831-1904), y a sus padres, su padre, Friedrich Miescher-His (1811-1887), fue profesor de anatomía. en Basilea natal de Miescher. En su correspondencia, Miescher mencionó otros tipos de células que había estudiado para detectar la presencia de nucleína, incluyendo hígado, riñón, células de levadura, eritrocitos y huevos de gallina, e insinuó haber encontrado nucleína también en estos (Miescher, 1869b His, 1897). . Además, Miescher también había planeado buscar nucleína en las plantas, especialmente en sus esporas (Miescher, 1869c). Ésta es una elección intrigante dada su posterior fascinación por las células germinales de vertebrados y su especulación sobre los procesos de fertilización y herencia (Miescher, 1871b, 1874).

Otra pista sobre los tejidos y tipos de células que Miescher podría haber examinado proviene de dos artículos publicados por Hoppe-Seyler, quien quería confirmar los resultados de su estudiante, que inicialmente vio con escepticismo, antes de su publicación. En el primero, otro de los estudiantes de Hoppe-Seyler, Pal Plósz, informó que la nucleína está presente en los eritrocitos nucleados de serpientes y aves pero no en los eritrocitos anucleares de las vacas (Plósz, 1871). En el segundo artículo, el propio Hoppe-Seyler confirmó los hallazgos de Miescher e informó que había detectado nucleína en células de levadura (Hoppe-Seyler, 1871).

En un apéndice a su artículo de 1871, publicado póstumamente, Miescher afirmó que la presencia aparentemente ubicua de nucleína significaba que "se ha encontrado un nuevo factor para la vida de los organismos más básicos y avanzados", abriendo así una una amplia gama de preguntas para la fisiología en general (Miescher, 1870). Argumentar que Miescher entendió que el ADN era un componente esencial de todas las formas de vida es probablemente una sobreinterpretación de sus palabras. Sin embargo, su declaración muestra claramente que creía que el ADN era un factor importante en la vida de una amplia gama de especies.

Además, Miescher examinó los tejidos en diferentes condiciones fisiológicas. Rápidamente notó que tanto la nucleína como los núcleos eran significativamente más abundantes en los tejidos en proliferación, por ejemplo, señaló que en las plantas, se encuentran grandes cantidades de fósforo predominantemente en las regiones de crecimiento y que estas partes muestran las densidades más altas de núcleos y células en proliferación activa ( Miescher, 1871a). Por tanto, Miescher había dado el primer paso para vincular la presencia de fósforo, es decir, ADN en este contexto, con la proliferación celular. Algunos años más tarde, mientras examinaba los cambios en los cuerpos de los salmones a medida que migraban río arriba a sus zonas de desove, notó que podía, con un mínimo esfuerzo, purificar grandes cantidades de nucleína pura de los testículos, ya que estaban en el punto álgido de la proliferación celular. en preparación para el apareamiento (Miescher, 1874).Esto proporcionó evidencia adicional de un vínculo entre la proliferación y la presencia de una alta concentración de nucleína.

Los comentarios más perspicaces de Miescher sobre este tema, sin embargo, datan de su tiempo en el laboratorio de Hoppe-Seyler en Tübingen. Estaba convencido de que los análisis histoquímicos conducirían a una comprensión mucho mejor de ciertos estados patológicos que los estudios microscópicos. También creía que los procesos fisiológicos, que en ese momento se consideraban similares, podrían resultar muy diferentes si se comprendiera mejor la química. Ya en 1869, año en que descubrió la nucleína, escribió en una carta a His: “Con base en las cantidades relativas de sustancias nucleares [ADN], proteínas y productos de degradación secundaria, sería posible evaluar la importancia fisiológica de cambios con mayor precisión de lo que es factible ahora ”(Miescher, 1869c).

Es importante destacar que Miescher propuso tres procesos ejemplares que podrían beneficiarse de tales análisis: "progresión nutritiva", caracterizada por un aumento de las proteínas citoplasmáticas y el agrandamiento de la "progresión generativa" celular, definida como un aumento de las "sustancias nucleares" (nucleína). y como fase preliminar de la división celular en células en proliferación y posiblemente en tumores y "regresión", una acumulación de lípidos y productos degenerativos (Miescher, 1869c).

Cuando consideramos las dos primeras categorías, Miescher parece haber entendido que un aumento en el ADN no solo estaba asociado con la proliferación celular, sino también como un requisito previo para la proliferación celular. Posteriormente, las células que ya no proliferan aumentarían de tamaño a través de la síntesis de proteínas y, por lo tanto, del citoplasma. Fundamentalmente, creía que los análisis químicos de estados tan diferentes le permitirían obtener una visión más fundamental de las causas subyacentes a estos procesos. Estas son percepciones asombrosamente proféticas. Lamentablemente, Miescher nunca siguió estas ideas y, aparte de los pensamientos expresados ​​en su carta, nunca publicó sobre el tema.

... Miescher parece haber comprendido que un aumento en el ADN no solo se asociaba con la proliferación celular, sino que también era un requisito previo

Sin embargo, es probable que tuviera datos preliminares que respalden estos puntos de vista. En general, Miescher tuvo cuidado de basar las declaraciones en hechos en lugar de especulaciones. Pero, siendo un perfeccionista que publicó solo después de una extensa verificación de sus resultados, presumiblemente nunca llevó a cabo estos estudios hasta un punto tan satisfactorio. Es posible que sus planes se vieron truncados al dejar el laboratorio de Hoppe-Seyler para recibir capacitación adicional bajo la supervisión de Carl Ludwig (1816-1895) en Leipzig. Mientras estuvo allí, Miescher centró su atención en asuntos que no tenían nada que ver con el ADN y solo reanudó su trabajo sobre la nucleína después de regresar a su Basilea natal en 1871.

Fundamentalmente para estos estudios posteriores de la nucleína, Miescher tomó una decisión importante: recurrió a los espermatozoides como su principal fuente de ADN. Al analizar los espermatozoides de diferentes especies, observó que los espermatozoides, especialmente los de salmón, tienen colas comparativamente pequeñas y, por lo tanto, consisten principalmente en un núcleo (Miescher, 1874). Inmediatamente comprendió que esto facilitaría enormemente sus esfuerzos por aislar el ADN con una pureza mucho mayor (Fig. 4). Sin embargo, Miescher también vio más allá de la posibilidad de obtener nucleína pura a partir del esperma de salmón. Se dio cuenta de que también indicaba que el núcleo y la nucleína que contenía podrían desempeñar un papel crucial en la fertilización y la transmisión de rasgos hereditarios. En una carta a su colega Rudolf Boehm (1844-1926) en Würzburg, Miescher escribió: “En última instancia, espero conocimientos de una importancia más fundamental que solo para la fisiología de los espermatozoides” (Miescher, 1871c). Fue el comienzo de una fascinación por los fenómenos de fertilización y herencia que ocuparían a Miescher hasta el final de sus días.

Miescher había entrado en este campo en un momento crítico. A mediados del siglo XIX, se había desafiado la vieja idea de que las células surgen a través de la generación espontánea. En cambio, se reconoció ampliamente que las células siempre surgen de otras células (Mayr, 1982). En particular, el desarrollo y la función de los espermatozoides y los ovocitos, que a mediados del siglo XIX se había demostrado que eran células, se vieron bajo una nueva luz. Además, en 1866, tres años antes de que Miescher descubriera el ADN, Ernst Haeckel (1834-1919) había postulado que el núcleo contenía los factores que transmiten los rasgos hereditarios. Esta propuesta de uno de los científicos más influyentes de la época llevó al núcleo al centro de atención de muchos biólogos. Habiendo descubierto la nucleína como una molécula distintiva presente exclusivamente en este orgánulo, Miescher se dio cuenta de que estaba en una excelente posición para hacer una contribución a este campo. Así, se propuso intentar caracterizar mejor la nucleína con el objetivo de correlacionar sus propiedades químicas con la morfología y función de las células, especialmente de los espermatozoides.

Sus análisis de la composición química de las cabezas de los espermatozoides de salmón llevaron a Miescher a identificar dos componentes principales: además de la nucleína ácida, encontró una proteína alcalina para la que acuñó el término 'protamina', nombre que todavía se usa hoy en día. pequeñas proteínas que reemplazan a las histonas durante la espermatogénesis. Además, determinó que estas dos moléculas se producen en una "asociación similar a la sal, no al éter [es decir, covalente]" (Miescher, 1874). Tras sus meticulosos análisis de la composición química de los espermatozoides, concluyó que, “aparte de las sustancias mencionadas [protamina y nucleína] no hay nada presente en cantidad significativa. Como esto es crucial para la teoría de la fertilización, llevo a cabo este negocio de la manera más cuantitativa posible desde el principio ”(Miescher, 1872a). Sus análisis le mostraron que el ADN y las protaminas en los espermatozoides ocurren en proporciones constantes, un hecho que Miescher consideró “ciertamente es de especial importancia”, sin, sin embargo, dar más detalles sobre cuál podría ser esta importancia. Hoy, por supuesto, sabemos que las proteínas, como las histonas y las protaminas, se unen al ADN en proporciones estequiométricas definidas.

Miescher pasó a analizar los espermatozoides de carpas, ranas (Rana esculenta) y toros, en los que confirmó la presencia de grandes cantidades de nucleína (Miescher, 1874). Es importante destacar que pudo demostrar que la nucleína está presente sólo en las cabezas de los espermatozoides (las colas están compuestas principalmente de lípidos y proteínas) y que dentro de la cabeza, la nucleína se encuentra en el núcleo (Miescher, 1874 Schmiedeberg y Miescher, 1896). Con este descubrimiento, Miescher no solo había demostrado que el ADN es un componente constante de los espermatozoides, sino que también dirigió su atención a las cabezas de los espermatozoides. Sobre la base de las observaciones de otros investigadores, como las de Albert von Kölliker (1817-1905) sobre la morfología de los espermatozoides en algunos miriápodos y arácnidos, Miescher sabía que los espermatozoides de algunas especies están aflagelados, es decir, carecen de cola. . Esto confirmó que la cabeza del esperma, y ​​por lo tanto el núcleo, era el componente crucial. Pero, la pregunta seguía siendo: ¿qué en los espermatozoides medía la fertilización y la transmisión de rasgos hereditarios de una generación a la siguiente?

Sobre la base de sus análisis químicos de los espermatozoides, Miescher especuló sobre la existencia de moléculas que tienen un papel crucial en estos procesos. En una carta a Boehm, Miescher escribió: “Si las sustancias químicas juegan un papel en la procreación, entonces el factor decisivo es ahora una sustancia conocida” (Miescher, 1872b). Pero Miescher no estaba seguro de qué podría ser esta sustancia. Sin embargo, sospechaba fuertemente que la combinación de nucleína y protamina era la clave y que el ovocito podría carecer de un componente crucial para poder desarrollarse: “Si ahora la diferencia decisiva entre el ovocito y una célula ordinaria sería la de la lista de factores, que explican un arreglo activo, se ha eliminado un elemento? Porque de lo contrario, todas las sustancias celulares adecuadas están presentes en el huevo ”, escribió más tarde (Miescher, 1872b).

Debido a su incapacidad para detectar protamina en el ovocito, Miescher inicialmente favoreció a esta molécula como responsable de la fertilización. Más tarde, sin embargo, cuando no pudo detectar protamina en los espermatozoides de otras especies, como los toros, cambió de opinión: “La Nucleína, por el contrario, ha demostrado ser constante [es decir, presente en los espermatozoides de todas las especies que Miescher analizó”. ] hasta aquí y sus asociaciones, dirigiré mi interés de ahora en adelante ”(Miescher, 1872b). Desafortunadamente, sin embargo, aunque se acercó tentadoramente, nunca estableció un vínculo claro entre la nucleína y la herencia.

La sección final de su artículo de 1874 sobre la aparición y las propiedades de la nucleína en los espermatozoides de diferentes especies de vertebrados es de particular interés porque Miescher trató de correlacionar sus hallazgos químicos sobre la nucleína con el papel fisiológico de los espermatozoides. Se había dado cuenta de que los espermatozoides representaban un sistema modelo ideal para estudiar el papel del ADN porque, como diría más tarde, “[p] o los problemas químico-biológicos reales, la gran ventaja de los espermatozoides [células] es que todo se reduce a las sustancias realmente activas y que son captadas justo en el momento en que ejercen su mayor función fisiológica ”(Miescher, 1893a). Apreció que sus datos aún estaban incompletos, pero quería hacer un primer intento para reunir sus resultados e integrarlos en una imagen más amplia para explicar la fertilización.

En ese momento, Wilhelm Kühne (1837-1900), entre otros, planteaba la idea de que los espermatozoides son portadores de sustancias específicas que, a través de sus propiedades químicas, logran la fertilización (Kühne, 1868). Miescher consideró sus resultados de la composición química de los espermatozoides en este contexto. Al considerar críticamente la posibilidad de que una sustancia química explique la fertilización, afirmó que: “si asumiéramos en absoluto que una sola sustancia, como una enzima o de cualquier otra forma, por ejemplo, como un impulso químico, podría ser la causa específica de la fertilización, sin lugar a dudas tendríamos que considerar ante todo Nuclein. Constantemente se descubrió que los cuerpos de nucleína eran los componentes principales [de los espermatozoides] ”(Miescher, 1874).

En retrospectiva, estas afirmaciones parecen sugerir que Miescher había identificado a la nucleína como la molécula que media la fertilización, una suposición crucial para dar seguimiento a su papel en la herencia. Desafortunadamente, sin embargo, el propio Miescher estaba lejos de estar convencido de que una molécula (o moléculas) fuera responsable de esto. Hay varias razones para su desgana, aunque la influencia de su tío fue presumiblemente un factor crucial, ya que fue él quien había sido fundamental para fomentar el interés del joven Miescher por la bioquímica y siguió siendo una fuerte influencia a lo largo de su vida. De hecho, cuando Miescher estuvo tentadoramente cerca de descubrir la función del ADN, las opiniones de His resultaron contraproducentes, probablemente impidiéndole interpretar sus hallazgos en el contexto de nuevos resultados de otros científicos en ese momento. Por lo tanto, Miescher no logró llevar sus estudios de la nucleína y su función en la fertilización y la herencia al siguiente nivel, lo que bien podría haber resultado en el reconocimiento del ADN como la molécula central en ambos procesos.

Un aspecto específico que desvió a Miescher de contemplar el papel de la nucleína en la fertilización fue un estudio previo en el que había identificado erróneamente las plaquetas de la yema de los ovocitos de pollo como una gran cantidad de gránulos que contienen nucleína (Miescher, 1871b). Esto lo llevó a concluir que la contribución cuantitativa comparativamente mínima del ADN de un espermatozoide a un ovocito, que ya contenía mucha más sustancia, no podría tener un impacto significativo en la fisiología de este último. Por tanto, concluyó que “no en una sustancia específica se puede ocultar el misterio de la fecundación. […] No una parte, sino el todo debe actuar mediante la cooperación de todas sus partes ”(Miescher, 1874).

Es aún más lamentable que Miescher haya identificado las plaquetas de la yema en los ovocitos como células que contienen nucleína porque se dio cuenta de que la presunta nucleína en estos gránulos difería de la nucleína (es decir, el ADN) que había aislado previamente de otras fuentes, en particular por su contenido de fósforo mucho más alto. Pero influenciado por la fuerte opinión de His de que estas estructuras eran células genuinas, Miescher vio sus resultados bajo esta luz. Solo varios años después, según los resultados de sus contemporáneos Flemming y Eduard A. Strasburger (1844-1912) sobre las propiedades morfológicas de los núcleos y su comportamiento durante las divisiones celulares, y los descubrimientos de Albrecht Kossel (1853-1927) sobre la composición del ADN ( Portugal y Cohen, 1977), ¿revisó Miescher su suposición inicial de que los ovocitos de pollo contienen una gran cantidad de gránulos que contienen nucleína? En cambio, finalmente admitió que las moléculas que comprenden estos gránulos eran diferentes de la nucleína (Miescher, 1890).

Otro factor que impidió a Miescher concluir que la nucleína era la base para la transmisión de rasgos hereditarios fue que no podía concebir cómo una sola sustancia podría explicar la multitud de rasgos hereditarios. ¿Cómo, se preguntó, podría una molécula específica ser responsable de las diferencias entre especies, razas e individuos? Aunque reconoció que “se producirán diferencias en la constitución química de estas moléculas [diferentes tipos de nucleína], pero sólo en un grado limitado” (Miescher, 1874).

Y así, en lugar de mirar a las moléculas, él, como su tío His, favoreció la idea de que el movimiento físico de los espermatozoides o una activación del ovocito, que comparó con la estimulación de un músculo por impulsos neuronales, era la responsable. para el proceso de fecundación: “Como el músculo durante la activación de su nervio, el ovocito, cuando recibe los impulsos adecuados, se convierte en una entidad química y físicamente muy diferente” (Miescher, 1874). Para la nucleína en sí, Miescher consideró que podría ser un material fuente para otras moléculas, como la lecitina, una de las pocas otras moléculas con un alto contenido de fósforo conocidas en ese momento (Miescher, 1870, 1871a, 1874). Miescher claramente prefirió la idea de la nucleína como depósito de material para la célula, principalmente fósforo, en lugar de como una molécula con un papel en la codificación de información para sintetizar tales materiales. Esta idea de que las moléculas grandes son el material fuente de las más pequeñas era común en ese momento y también se contemplaba para las proteínas (Miescher, 1870).

Toda la sección del artículo de 1874 de Miescher en el que analiza el papel fisiológico de la nucleína se lee como si estuviera tratando deliberadamente de reunir pruebas en contra de que la nucleína sea la molécula clave en la fertilización y la herencia. Este enfoque despectivo hacia la molécula que él mismo había descubierto también podría explicarse, al menos en cierta medida, por su pronunciada tendencia a ver sus resultados de manera tan crítica y reveladora, que publicó solo unos 15 artículos y conferencias en una carrera que abarca casi tres décadas.

La comprensión moderna de que la fertilización se logra mediante la fusión de dos células germinales no se estableció hasta el último cuarto del siglo XIX. Antes de ese momento, la opinión casi omnipresente era que el espermatozoide, a través del mero contacto con el óvulo, de alguna manera estimulaba el desarrollo del ovocito: el punto de vista fisicalista. El suyo fue un defensor clave de este punto de vista y rechazó firmemente la idea de que una sustancia específica pudiera mediar en la herencia. Solo podemos especular sobre cómo habría interpretado Miescher sus resultados si hubiera trabajado en un entorno intelectual diferente en ese momento, o si hubiera sido más independiente en la interpretación de sus resultados.

Solo podemos especular sobre cómo habría interpretado Miescher sus resultados si hubiera trabajado en un entorno intelectual diferente en ese momento ...

La negativa de Miescher a aceptar la nucleína como clave para la fertilización y la herencia es particularmente trágica en vista de varios estudios que aparecieron a mediados de la década de 1870, centrando la atención de los científicos en los núcleos. Leopold Auerbach (1828-1897) demostró que los óvulos fecundados contienen dos núcleos que se mueven uno hacia el otro y se fusionan antes del desarrollo posterior del embrión (Auerbach, 1874). Esta observación sugirió fuertemente un papel importante para los núcleos en la fertilización. En un estudio posterior, Oskar Hertwig (1849-1922) confirmó que los dos núcleos, uno del espermatozoide y otro del ovocito, se fusionan antes de que comience la embriogénesis. Además, observó que todos los núcleos del embrión derivan de este núcleo inicial en el cigoto (Hertwig, 1876). Con esto había establecido que un solo espermatozoide fertiliza el ovocito y que existe un linaje continuo de núcleos desde el cigoto durante todo el desarrollo. Al hacerlo, asestó el golpe de gracia a la visión fisicalista de la fertilización.

A mediados de la década de 1880, Hertwig y Kölliker ya habían postulado que el componente crucial del núcleo que medía la herencia era la nucleína, una idea que posteriormente fue aceptada por varios científicos. Lamentablemente, Miescher mantuvo sus dudas hasta su muerte en 1895 y, por lo tanto, no pudo apreciar la verdadera importancia de su descubrimiento. Esto podría haber sido una reacción exagerada a las afirmaciones de otros de que las cabezas de los espermatozoides se forman a partir de una sustancia homogénea que Miescher había demostrado claramente que también contienen otras moléculas, como proteínas. Además, la suposición errónea de Miescher de que la nucleína se producía solo en la capa exterior de la cabeza del espermatozoide resultó en su incapacidad para darse cuenta de que las manchas de cromatina, que tiñen los centros de las cabezas, en realidad etiquetan la región donde hay nucleína, aunque más tarde se dio cuenta de que prácticamente toda la cabeza del esperma está compuesta de nucleína y proteína asociada (Miescher, 1892a Schmiedeberg & Miescher, 1896).

Desafortunadamente, no solo Miescher, sino toda la comunidad científica pronto perderían la fe en el ADN como molécula que media la herencia. El trabajo de Miescher había establecido al ADN como un componente crucial de todas las células e inspiró a otros a comenzar a explorar su papel en la herencia, pero con el surgimiento de la hipótesis del tetranucleótido a principios del siglo XX, el ADN cayó en desgracia y fue reemplazado por proteínas como el factor principal. candidatos principales para esta función. La hipótesis del tetranucleótido, que suponía que el ADN estaba compuesto por subunidades idénticas, cada una con las cuatro bases, prevaleció hasta finales de la década de 1940, cuando Edwin Chargaff (1905-2002) descubrió que las diferentes bases del ADN no estaban presentes en cantidades equimolares (Chargaff et al, 1949, 1951 ).

Desafortunadamente, no solo Miescher, sino toda la comunidad científica pronto perdería la fe en el ADN como molécula que media la herencia.

Solo unos años antes, en 1944, los experimentos de Avery y sus colegas habían demostrado que el ADN era suficiente para transformar las bacterias (Avery et al, 1944).Luego, en 1952, Al Hershey (1908-1997) y Martha Chase (1927-2003) confirmaron estos hallazgos al observar que el ADN viral, pero ninguna proteína, ingresa a la bacteria durante la infección con el bacteriófago T2 y que este ADN también está presente en nuevos virus producidos por bacterias infectadas (Hershey y Chase, 1952). Finalmente, en 1953, las imágenes de rayos X del ADN permitieron a Watson y Crick deducir su estructura (Watson & Crick, 1953) y así comprender cómo funciona el ADN. Es importante destacar que estos experimentos fueron posibles gracias a los avances en bacteriología y virología, así como al desarrollo de nuevas técnicas, como el marcaje radiactivo de proteínas y ácidos nucleicos, y la cristalografía de rayos X, recursos que estaban más allá del alcance de Miescher y sus colaboradores. contemporáneos.

En años posteriores (Fig. 5), la atención de Miescher pasó progresivamente del papel de la nucleína en la fertilización y la herencia a cuestiones fisiológicas, como las relacionadas con los cambios metabólicos en los cuerpos del salmón, ya que producen cantidades masivas de células germinales a expensas del músculo. tejido. Aunque hizo contribuciones importantes y fundamentales en diferentes áreas de la fisiología, fue cada vez más negligente en explorar su línea de investigación más prometedora, la función del ADN. Solo hacia el final de su vida volvió a esta cuestión y comenzó a reconsiderar el tema bajo una nueva luz, pero no logró más avances.

Sin embargo, un área en la que propuso hipótesis intrigantes, aunque sin datos experimentales que las respalden, fue la base molecular de la herencia. Inspirado por el trabajo de Darwin sobre fertilización en plantas, Miescher postuló, por ejemplo, cómo la información podría estar codificada en moléculas biológicas. Afirmó que, "para mí, la clave de la sexualidad radica en la estereoquímica", y expuso su creencia de que las gemas de la teoría de la pangénesis de Darwin probablemente fueran "numerosos átomos de carbono asimétricos [presentes en] sustancias orgánicas" (Miescher, 1892b), y que la reproducción sexual podría funcionar para corregir errores en su “arquitectura estereométrica”. Como tal, Miescher propuso que la información hereditaria podría estar codificada en macromoléculas y cómo se podrían corregir los errores, lo que suena misteriosamente como si hubiera predicho lo que ahora se conoce como la complementación de las deficiencias haploides con alelos de tipo salvaje. Es particularmente tentador suponer que Miescher podría haber pensado que este era el caso, ya que Mendel había publicado sus leyes de herencia de características recesivas más de 25 años antes. Sin embargo, no hay ninguna referencia al trabajo de Mendel en los papeles, charlas o cartas que nos ha dejado Miescher.

Miescher propuso que la información hereditaria podría codificarse en macromoléculas y cómo se podrían corregir los errores ...

Lo que sí sabemos es que Miescher expuso su punto de vista sobre cómo la información hereditaria podría almacenarse en macromoléculas: “En las enormes moléculas de proteína […] los muchos átomos de carbono asimétricos permiten un número tan colosal de estereoisómeros que toda la abundancia y diversidad de la transmisión de [rasgos] hereditarios puede encontrar su expresión en ellos, como lo hacen las palabras y términos de todos los idiomas en las 24-30 letras del alfabeto. Por lo tanto, es completamente superfluo ver el espermatozoide o el ovocito como un depósito de innumerables sustancias químicas, cada una de las cuales debería ser portadora de un rasgo hereditario especial (de Vries Pangenesis). El protoplasma y el núcleo, que mis estudios han demostrado, no se componen de innumerables sustancias químicas, sino de muy pocos individuos químicos, que, sin embargo, quizás tengan una estructura química muy compleja ”(Miescher, 1892b).

Este es un pasaje notable en los escritos de Miescher. La segunda mitad del siglo XIX fue testigo de una intensa especulación sobre cómo se transmiten las características hereditarias entre generaciones. El punto de vista de consenso asumió la participación de partículas diminutas, que se pensaba que daban forma al desarrollo embrionario y median la herencia (Mayr, 1982). Miescher contradijo este punto de vista. En lugar de una multitud de partículas individuales, cada una de las cuales podría ser responsable de un rasgo (o rasgos) específico, sus resultados habían demostrado que, por ejemplo, las cabezas de los espermatozoides se componen de muy pocos compuestos, principalmente ADN y proteínas asociadas. .

Elaboró ​​más en su teoría de cómo la información hereditaria podría almacenarse en moléculas grandes: “La continuidad no solo reside en la forma, también se encuentra más profunda que la molécula química. Se encuentra en los grupos constituyentes de átomos. En este sentido soy partidario de un modelo químico de herencia. à outrance [al máximo] ”(Miescher, 1893b). Con esta afirmación Miescher rechaza firmemente cualquier idea de preformación o alguna continuidad morfológica transmitida a través de las células germinales. En cambio, parece prever claramente lo que solo se conocería mucho más tarde: la base de la herencia se encontraba en la composición química de las moléculas.

Para explicar cómo se podría lograr esto, propuso un modelo de cómo se podría codificar la información en una macromolécula: “Si, como es fácilmente posible, una molécula de proteína comprende 40 átomos de carbono asimétricos, habrá 2 40, es decir, aproximadamente un billones de isomerismos [sic]. Y este es solo uno de los posibles tipos de isomería [sin considerar otros átomos, como el nitrógeno]. Para lograr la diversidad incalculable que exige la teoría de la herencia, mi teoría se adapta mejor que cualquier otra. Son concebibles todo tipo de transiciones, desde las diferencias imperceptibles hasta las más grandes ”(Miescher, 1893b).

Las ideas de Miescher sobre cómo se pueden transmitir y codificar las características hereditarias encapsulan varios conceptos importantes que desde entonces se ha demostrado que son correctos. Primero, creía que la reproducción sexual servía para corregir errores o mutaciones como las llamamos hoy. En segundo lugar, postuló que la transmisión de rasgos hereditarios ocurre a través de una o unas pocas macromoléculas con composiciones químicas complejas que codifican la información, en lugar de por numerosas moléculas individuales, cada una de las cuales codifica rasgos únicos, como se pensaba en ese momento. En tercer lugar, previó que la información está codificada en estas moléculas a través de un código simple que da como resultado un número asombrosamente grande de posibles rasgos hereditarios y, por lo tanto, explica la diversidad de especies e individuos observados.

Las ideas de Miescher sobre cómo se pueden transmitir y codificar las características hereditarias encapsulan varios conceptos importantes que desde entonces se ha demostrado que son correctos.

Es un paso demasiado lejos sugerir que Miescher entendió qué hacen el ADN u otras macromoléculas, o cómo se almacena la información hereditaria. Simplemente no podría haberlo hecho, dado el contexto de su época. Sus hallazgos e hipótesis, que hoy en día encajan perfectamente y a menudo parecen anticipar nuestra comprensión moderna, probablemente parecieron bastante inconexos para Miescher y sus contemporáneos. En su día, todavía quedaban en duda demasiados hechos y demasiados vínculos tenues. Siempre existe el peligro de sobreinterpretar las especulaciones e hipótesis formuladas hace mucho tiempo a la luz de hoy. Sin embargo, aunque el propio Miescher malinterpretó algunos de sus hallazgos, gran parte de sus conclusiones se acercó asombrosamente a lo que ahora sabemos que es cierto. Además, su trabajo influyó en otros para que realizaran sus propias investigaciones sobre el ADN y su función (Dahm, 2008). Aunque la investigación del ADN pasó de moda durante varias décadas después de finales del siglo XIX, la información recopilada por Miescher y sus contemporáneos sentó las bases de los experimentos decisivos llevados a cabo a mediados del siglo XX, que establecieron de manera inequívoca la función del ADN. .

Como tal, quizás el aspecto más trágico de la carrera de Miescher fue que durante la mayor parte de su vida creyó firmemente en las teorías fisicalistas de la fertilización, como lo proponían His y Ludwig, entre otros, y su renuencia a combinar los resultados de sus rigurosos análisis químicos con los datos "más suaves" generados por citólogos e histólogos. Si hubiera establecido el vínculo entre la nucleína y los cromosomas y hubiera aceptado su papel clave en la fertilización y la herencia, podría haberse dado cuenta de que la molécula que había descubierto era la clave de algunos de los mayores misterios de la vida. De hecho, murió con el sentimiento de una carrera prometedora incumplida (His, 1897), cuando, en realidad, sus contribuciones iban a eclipsar a las de la mayoría de sus contemporáneos.

... murió con la sensación de una carrera prometedora incumplida [...] cuando, en realidad, sus contribuciones iban a eclipsar a las de la mayoría de sus contemporáneos

Es tentador especular sobre el camino que las investigaciones de Miescher —y la biología en su conjunto— podrían haber tomado en circunstancias ligeramente diferentes. ¿Qué hubiera sucedido si hubiera seguido sus resultados preliminares sobre el papel del ADN en diferentes condiciones fisiológicas, como la proliferación celular? ¿Cómo habrían cambiado sus teorías sobre la fecundación y la herencia si no hubiera sido engañado por la identificación errónea de lo que le parecía ser una multitud de pequeños núcleos en el ovocito? ¿O cómo habría interpretado sus hallazgos sobre la nucleína si no hubiera sido influenciado por los puntos de vista de su tío, sino también por los de la comunidad científica más amplia?

Hay una lección más general en la vida y obra de Friedrich Miescher que va más allá de sus éxitos y fracasos inmediatos. Su historia es la de un investigador brillante que desarrolló enfoques experimentales innovadores, eligió los sistemas biológicos adecuados para abordar sus preguntas y realizó descubrimientos revolucionarios y, sin embargo, se vio limitado por su entorno intelectual y, por lo tanto, se le impidió interpretar sus hallazgos de manera objetiva. Por lo tanto, correspondió a otros, que vieron su trabajo desde un nuevo punto de vista, hacer las inferencias cruciales y así establecer la función del ADN.


EL MUNDO MICROBIANO: UNA PERSPECTIVA HISTÓRICA

Como puede imaginar, esta historia tiene que estar muy condensada porque el número de personas íntimamente involucradas en resolver la naturaleza molecular y el modo de acción del ADN es realmente muy grande. Pero, sin embargo, es una gran historia.

Friedrich Miescher, tenía 25 años en 1869 cuando descubrió el ADN y estaba

totalmente desconocido. Descubrió el ADN en el núcleo de la célula. Sugirió que el núcleo podría tener una composición química única y tener una función importante. Y esto fue en un momento en que la mayoría de los investigadores creían que no había nada único en el núcleo y que era una estructura celular relativamente poco importante.

En 1866 Ernst Haeckel, un anatomista muy respetado de la época, hizo algunas declaraciones bastante profundas sobre la estructura celular que se tomaron en serio de inmediato. Dijo que el núcleo prevé la transmisión de caracteres hereditarios, el plasma externo por otro lado es para acomodación o adaptación al mundo externo. A partir de entonces, la atención se mantuvo centrada en el núcleo, la naturaleza de su química y la naturaleza de su función.

Después de muchos años de química dura y mucha discusión, desde aproximadamente 1909 hasta principios de la década de 1940, era un dogma casi indiscutible que las cuatro bases de nucleótidos, ATGC, estaban presentes en proporciones iguales en los ácidos nucleicos. Recuerde que el avance tecnológico en la maquinaria de la ciencia moderna estaba todavía muy lejos. Esta idea de cantidades iguales de bases en los ácidos nucleicos llevó a la formulación de lo que se conoció como la hipótesis del tetranucleótido para la estructura de los ácidos nucleicos. Esto se puso en tela de juicio cuando otros estudios más refinados que utilizaban técnicas más sofisticadas demostraron que el peso molecular del ADN era de un millón o más, mientras que el peso molecular de un tetranucleótido es inferior a 10.000. Pero ninguna función bien entendida o generalmente aceptada fue evidente para el ADN.

Para continuar la historia, comenzaremos con Gregor Mendel, un monje que, a mediados del siglo XIX, disfrutaba jugando en el jardín apareando guisantes. Para abreviar una historia larga y complicada, el mensaje principal de estos coqueteos sexuales fue que existe un mecanismo por el cual las plantas, y todas las criaturas en general, transmiten sus características físicas a sus descendientes. A ese mecanismo lo llamamos herencia, y se lleva a cabo mediante la transferencia fiel, y subrayo la transferencia fiel, es decir, precisa, de genes que codifican todas sus características, visibles e invisibles, a su descendencia. Tus genes dicen quién eres. Por supuesto, Nurture juega un papel muy importante en nuestro resultado final, pero lo ignoraremos en nuestra historia. Y me enorgullece decir que la microbiología tuvo una gran voz en la historia del ADN y la herencia.

Nuestro próximo protagonista en la historia es Charles Darwin, un biólogo que propuso la teoría de la evolución. Básicamente, lo que dijo Darwin fue que la fuerza natural que impulsaba la evolución era la lucha por la existencia. Thomas Malthus había dicho que las poblaciones naturales producían más individuos de los que podían alimentar. La competencia por la comida resultó en la muerte de los menos capaces de competir. A partir de esto, Darwin concluyó que los organismos más capaces de adaptarse a las condiciones externas actuales tenían más probabilidades de sobrevivir y reproducirse. Las variaciones fortuitas que daban ventajas para la supervivencia se mantuvieron mediante la reproducción, las que resultaron desventajosas desaparecieron como consecuencia de la muerte de los organismos. Durante largos períodos de tiempo, este interminable proceso dio lugar a nuevas variedades y nuevas especies.

Usando esta teoría podemos explicar cómo es que somos tan parecidos a nivel molecular, sin embargo, como grupo, podemos tener una gran variedad de características físicas, desde monos hasta pollos, hormigas y gusanos. Nos parecemos a nivel molecular porque compartimos un gran porcentaje de nuestros genes con otros animales y plantas. Somos tan similares a los simios superiores que compartimos un 97% o más de homología de ADN, lo que significa que nuestros genes son extremadamente similares y, en muchos casos, idénticos. Esto se comprende fácilmente cuando nos damos cuenta de que surgimos de una célula primordial que evolucionó, a través de los eones de tiempo, y finalmente dio lugar a la multitud de tipos biológicos que existen hoy en la tierra. Si el tiempo lo permite, podemos volver a este interesante tema más adelante en el curso.

Ahora bien, si todos los seres vivos surgieron de una célula primordial, es comprensible por qué deberíamos ser tan parecidos a nivel molecular. Heredamos en el proceso de evolución todos los genes de nuestros padres. Estos genes están experimentando cambios, las llamamos mutaciones, y aparecen nuevos genes a medida que avanzamos en el proceso evolutivo. Por evolución me refiero a nada más que a la selección de la forma más apta que se adapta a cualquier cambio en el entorno. Tiene sentido que solo las formas más aptas sobrevivan y sobrevivan a todas las demás formas. Como ejemplo, considere nuestro problema actual del calentamiento global. Solo sobrevivirán aquellas formas capaces de tolerar y multiplicarse a temperaturas más altas. Todos los demás perecerán.

La siguiente persona en mi lista es un inglés, Fred Griffith, un médico que trabajaba en el laboratorio de patología del Ministerio de Salud británico. Fue un microbiólogo que trabajó en la década de 1920 en la transferencia de virulencia en el organismo que causa la neumonía. Fue el primero en describir las formas suave y rugosa del neumococo y asociarlas con la virulencia. Por virulencia me refiero a la capacidad de un organismo para causar enfermedad en el hombre. Una de las características del neumococo, el agente causante de la neumonía bacteriana, es que los organismos que se encuentran en el esputo de los pacientes enfermos de neumonía tienen una cápsula que recubre la pared celular. La presencia de una cápsula es fácil de detectar en placas de Petri porque las células forman colonias muy lisas. Se llaman mantecosos en apariencia. Una cápsula también es fácilmente visible en las células en el microscopio, especialmente después de la tinción. Esta cápsula es de composición química variable entre las diferentes cepas de neumococos y estos diferentes tipos capsulares, como se denominan, pueden diferenciarse por medios serológicos simples y se designan con números romanos.

El descubrimiento de Griffith de las formas S y R de los neumococos se realizó en 1923. Hizo la observación fundamental de que, cuando se inyectan grandes cantidades de células R avirulentas en ratones, a menudo es posible recuperar células S que son completamente virulentas y tienen la mismo tipo de cápsula que aquella de la que se derivaron las células R. Concluyó que el carácter de virulencia se conserva, pero no se expresa en las células R, y que el cuerpo animal actúa como un medio selectivo en el que solo las formas S pueden multiplicarse. Después de mucha experimentación, concluyó que la variación S & amp R es un cambio mutacional reversible.

Griffith estaba interesado en el papel de los tipos de cápsulas en la virulencia. Observó que cuando una cepa suave o S que se origina de una cepa de neumococo tipo III en cápsula se subcultiva en serie, es decir, se transfiere de una placa de crecimiento a una nueva, en ocasiones aparece una colonia rugosa, llamada R, en la placa. Las células que componen esta colonia carecen de la cápsula, y eso hace que la colonia sea rugosa. Y las colonias R son verdaderas, es decir, siempre dieron lugar a colonias R. Pero lo más interesante de todo es que estas células R son avirulentas, no matan ratones, mientras que las células lisas S de las que se originaron sí lo hacen.

En 1928 Fred Griffith hizo una observación sorprendente. Cuando se inoculó un gran número de células R derivadas de un tipo I liso debajo de la piel de un ratón junto con un tipo II S destruido por calor, el ratón murió en unos pocos días. Sobrevivieron los ratones que solo recibieron S tipo II matado por calor. Los ratones que recibieron solo las células R también sobrevivieron. La sangre de los ratones muertos produjo solo células S tipo II. Pero recuerde que las células lisas de tipo II inoculadas en el animal habían muerto por calor, por lo que esta no era la fuente de las nuevas células S de tipo II. Llegaron a la conclusión, después de muchos experimentos de control, que las células muertas de tipo II habían secretado algo que les confería a las células R la capacidad de fabricar un nuevo tipo de cápsula. Descubrieron que la propiedad transferida era heredable, por lo que habían generado una nueva especie. Llamaron a esta transferencia de material genético de una célula microbiana a otra célula, Transformación. Ahora, tenga en cuenta que esta fue la primera vez en la historia que se observó transferencia de material genético en bacterias. Nadie siquiera había considerado esta posibilidad. Fue increíble.

Otros entraron en escena y descubrieron que podían obtener la misma transformación de tipo de cápsula in vitro, en el tubo de ensayo, simplemente mezclando células tipo II S muertas por calor con R tipo I S y colocando la mezcla en placas. Otros demostraron que podían realizar el experimento de transformación mezclando extractos libres de células de células S muertas por calor con células receptoras R. Claramente, había algo en este extracto libre de células que actuaba como un gen, es decir, transfiriendo caracteres hereditarios. A este algo se le dio el nombre de Principio Transformador.

En 1944, Ostwald T. Avery, Colin MacLeod y Maclin McCarty, tres microbiólogos que trabajaban en el Instituto Rockefeller en Nueva York, lograron purificar el principio transformador del neumococo y descubrieron que estaba compuesto únicamente de ADN. Esto era algo herético porque hasta ese momento se creía generalmente que lo único lo suficientemente complejo en una célula para comportarse como un gen era la proteína.Verá, los ácidos nucleicos tienen solo cuatro subunidades de componentes, A, T, G, C, lo que limita las posibilidades de variación dentro de los tetranucleótidos, mientras que las proteínas pueden estar formadas por más de 20 aminoácidos diferentes, lo que da lugar a la posibilidad de un infinito número de posibles permutaciones en la estructura y, por tanto, un número ilimitado de genes. En cualquier caso, la historia dice que si estos tipos no hubieran estado trabajando en el Instituto Rockefeller en Nueva York, es posible que no hubieran podido caracterizar el Principio Transformador. Verá, el Rockefeller es un lugar muy interno y amigable y todos saben lo que todos están haciendo. La pepsina, una enzima que degrada las proteínas específicamente, se había purificado allí recientemente. A Avery le dieron algo de esta pepsina pura y le dijeron: "Aquí esto degradará tu principio transformador". Así que Avery trató de degradar su principio transformador semipurificado incubándolo con pepsina y luego probándolo en un experimento de transformación. Bueno, la enzima no degradó el principio transformador. Entonces ahora comenzaron a buscar otras enzimas que degradarían su principio transformador. La ribonucleasa, una enzima que degrada el ácido ribonucleico específicamente, no tuvo ningún efecto sobre el principio de transformación. McCartyi purificó la ADNasa, la enzima que degrada el ADN, y se eliminó la transformación. Descubrió que la ADNasa degradaría su principio transformador. Lograron purificar el principio transformador y descubrieron que estaba compuesto de ADN. La actividad biológica de Ite era tan grande que era capaz de provocar la transformación incluso cuando se usaba en una dilución final de menos de 1 en 100.000.000 en el sistema de reacción.

El documento no fue recibido con gran éxito. Por un lado, fue publicado en una revista médica, no microbiológica o bioquímica. Lo más importante de todo es que la gente no estaba convencida de que una molécula tan simple como el ADN pudiera tener la flexibilidad suficiente para codificar las miles de proteínas de una célula. Solo las proteínas contenían este potencial de codificación. Así que el papel de Avery no apestaba demasiado.

Sin embargo, algunas personas lo leyeron y lo aceptaron. Edwin Chargaff cambió todo su proyecto de investigación para estudiar los ácidos nucleicos después de leer el artículo de Avery. Chargaff hizo algunos descubrimientos muy fundamentales con respecto a la estructura del ADN. Usó una técnica simple para medir las cantidades relativas de los cuatro nucleótidos en muestras de ADN de una variedad de vertebrados y muchas bacterias. Mientras que algunas especies tenían ADN en el que predominaban la adenina y la timina, otras tenían ADN con más guanina y citosina. Por tanto, se presentó la posibilidad de que dos moléculas de ADN no tuvieran la misma composición. Además, mostró que invariablemente la concentración de adenina siempre era igual a la de timina y lo mismo para la guanina y la citosina, que eran siempre iguales en concentración. Esto llegó a conocerse como la regla de Chargaff y fue de gran importancia en la generación del modelo de ADN.

Se necesitó un experimento con un sistema biológico completamente diferente al utilizado por Avery para lograr la aceptación universal del papel genético del ADN. Alfred Hershey y Martha Chase utilizaron un virus que infecta a las bacterias, llamado bacteriófago, o fago para abreviar, para demostrar que el ADN era el portador de información genética. Muy brevemente, los fagos son virus específicos de bacterias compuestos únicamente de proteína y ARN o ADN, nada más. Ahora, las proteínas contienen el elemento S mientras que los ácidos nucleicos no contienen S, y los ácidos nucleicos contienen fósforo, mientras que las proteínas no. El fago T2 marcado con Hershey y Chase, que infecta a la bacteria E. coli, ya sea con S radiactivo (S35) que se incorpora a las proteínas de T2 o con fósforo radiactivo (P32) que ingresa al ácido nucleico de T2. Luego incubaron la T2 etiquetada individualmente con E. coli, dejaron unos minutos para que los fagos se unieran y hicieran lo suyo, y luego mezclaron la mezcla y centrifugaron los cuerpos de fagos liberados. Descubrieron que solo el ADN marcado con P32 entraba en las células, mientras que la proteína marcada con S35 permanecía fuera de las células y se eliminaba mediante la mezcla. Dado que las células produjeron la progenie del fago T2, esto prueba que el ADN es el material genético.

Unos años más tarde, Bob Romig, profesor de microbiología en UCLA en ese momento, hizo el experimento decisivo. Hizo el muy laborioso experimento de aislar el ADN de un fago de B. subtilis intacto, es decir, como una molécula circular grande, y lo usó para transformar un cultivo de B. subtilis, lo que dio lugar a una explosión de partículas de fago.

Y luego, en 1953, apareció el artículo de James Watson y Francis Crick con su propuesta para la estructura del ADN. Este artículo es tan importante porque explica de manera fácil y muy precisa cómo funcionan los genes, cómo se replican y cómo pueden cambiar, es decir, mutar. Probablemente sea la obra científica más importante del siglo XX. En toda la historia de la ciencia biológica, solo el reconocimiento de Darwin de la existencia y el mecanismo fundamental de la evolución ha igualado en importancia al descubrimiento. Y todo esto se dijo en una página en un artículo de Nature.

Básicamente, el ADN está formado por dos cadenas enormemente largas de moléculas ATGC ordenadas específicamente unidas entre sí formando una doble hélice. El ADN sirve como diccionario para escribir la información genética necesaria para hacer que una célula se divida fielmente. Utiliza un código triplete para cada aminoácido de una proteína, es decir, tres nucleótidos específicos codifican un aminoácido en el producto proteico final del gen. Fue un joven bioquímico de los Institutos Nacionales de Salud llamado Marshall Nirenberg, quien descubrió por primera vez que el triplete UUU en el ARN codifica el aminoácido fenilalanina. Esta fue la primera letra del alfabeto del ADN, y los tripletes restantes fueron identificados principalmente por Severo Ochoa y Gobind Khorana y otros que idearon métodos para sintetizar polímeros de estructura definida de ATG o C en todas las posibles permutaciones de tripletes. Este trabajo fue de tal importancia que Nirenberg y Khorana compartieron el Premio Nobel en 1968.

Como un aparte, permítanme decir que no todo fue siempre color de rosa para que el ADN tuviera algún papel en la herencia. Especialmente cuando Wendell Stanley cristalizó el virus del mosaico del tabaco en 1935 y descubrió que estaba compuesto principalmente de proteínas con menor cantidad de ARN. Además, se descubrieron cambios en la estructura de la proteína del virus, mientras que las cantidades de fósforo en los ácidos nucleicos eran prácticamente idénticas, lo que sugiere que se mantuvo constante mientras cambiaba la proteína. Por tanto, se pensó que la diversidad de proteínas significaba que comprendían los genes del virus.

La replicación del ADN se produce mediante la separación de las hebras de Watson y Crick de la doble hélice, seguida de la síntesis de las copias complementarias de las dos hebras separadas que producen dos dobles hélices idénticas. Cuando se copia la molécula completa, se pasa una hélice a la célula hija y la otra se queda con la madre.

Permítanme contarles sobre lo que se ha llamado el experimento más hermoso de la biología. Fue realizado por dos hombres muy jóvenes, uno postdoctorado y el otro profesor asistente principiante en la Universidad Estatal de Oregon. El experimento se llama el experimento meselson, stahl en honor a los inventores. Lo que querían hacer estos chicos era probar la idea propuesta por Watson y Crick de que la replicación del ADN implicaba la separación de las dos hebras de la doble hélice seguida de la copia de estas dos hebras. No todo el mundo estaba convencido de que la separación de las hebras pudiera ser tan fácil. Max Delbruck pensó que desabrochar el adn podía dar lugar a nudos.

Meselson y stahl utilizaron una técnica de centrifugación que les permitió separar moléculas de acuerdo con ligeras diferencias en el peso molecular. después de un giro centrífugo, las moléculas más pesadas terminan más cerca de la parte inferior del tubo de ensayo que las más ligeras que permanecen más cerca de la parte superior. Debido a que los átomos de nitrógeno son un componente del adn, y debido a que el nitrógeno existe en dos formas, un átomo pesado n15 y el n14 natural, Meselson y Stahl podrían etiquetar su adn con n15 simplemente cultivando las bacterias en sulfato de amonio n15. Todo su ADN estaría marcado con n15 y formaría una banda pesada de ADN que migraría más abajo en el tubo de centrífuga. De este cultivo, tomaron una muestra y reemplazaron el medio para que ahora contenga sulfato de amonio n14, lo que garantiza que la siguiente ronda de replicación del ADN haría uso de la luz n14. Si, como predijeron Watson y Crick, descomprimir seguido de copiar, entonces las dos hebras de adn nacientes en el experimento deberían ser híbridos compuestos por una hebra parental pesada n 15 y una hebra n14 ligera naciente y la banda de adn debería migrar más arriba en el tubo de centrífuga después del centrifugado. Un mayor crecimiento del cultivo da como resultado la descompresión y copia continuas de la molécula de ADN de doble hebra. Entonces, para la tercera generación, separar las bandas de ADN híbridas y copiarlas dará como resultado una doble hélice n14 pura y una hélice híbrida. Esta banda n14 migrará aún más alto en el tubo que el híbrido debido a su peso más ligero. Creo que la ilustración lo aclarará.

Las mutaciones ocurren por la incorporación de un error ocasional en el ADN durante el proceso de replicación, es decir, la inserción de ag en lugar de a en una hebra mientras se está copiando dará lugar a un cambio en el aminoácido en el producto proteico, por lo tanto cambiando la proteína y posiblemente afectando su función. No todas las mutaciones tienen por qué ser dañinas. Solo aquellos cambios mutacionales que alteren la estructura física de la proteína afectarán su función.

Como puede ver, el modelo de ADN de Watson-Crick realmente explica el funcionamiento de los genes y el proceso de la herencia en su conjunto. Ciertamente valió la pena el premio Nobel.

Este mismo mecanismo exacto de herencia se ve en bacterias, babuinos, loros y elefantes y hormigas. Realmente somos muy similares en nuestros conceptos básicos. Acepta la evolución y acepta a darwin y acepta el adn. Todo está aquí para quedarse.

La presencia de bacterias hace 3 mil millones de años puede indicar la presencia de un código genético funcional en ese momento. La notable similitud en las secuencias de bases de codones reconocidas por los sistemas de síntesis de proteínas de bacterias, anfibios y mamíferos, sugiere que la mayoría, si no todas, las formas de vida en este planeta usan casi el mismo lenguaje genético, y que el lenguaje se ha utilizado, posiblemente con pocos cambios importantes, durante al menos 500 mil millones de años.


Ver el vídeo: ALFRED HERSHEY AND MARTHA CHASE EXPERIMENT DNA AS HERIDITARY MATERIAL (Febrero 2023).